Incidental Mutation 'R5488:Pcdh10'
ID430447
Institutional Source Beutler Lab
Gene Symbol Pcdh10
Ensembl Gene ENSMUSG00000049100
Gene Nameprotocadherin 10
Synonyms6430521D13Rik, OL-pc, 6430703F07Rik
MMRRC Submission 043049-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.470) question?
Stock #R5488 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location45378398-45435623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45381368 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 706 (G706S)
Ref Sequence ENSEMBL: ENSMUSP00000141529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166126] [ENSMUST00000170695] [ENSMUST00000171554] [ENSMUST00000193252]
Predicted Effect probably benign
Transcript: ENSMUST00000166126
AA Change: G706S

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131073
Gene: ENSMUSG00000049100
AA Change: G706S

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
Pfam:Cadherin_C_2 713 838 5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170695
AA Change: G706S

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000132769
Gene: ENSMUSG00000049100
AA Change: G706S

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171554
AA Change: G706S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000131600
Gene: ENSMUSG00000049100
AA Change: G706S

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191843
Predicted Effect probably damaging
Transcript: ENSMUST00000193252
AA Change: G706S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141529
Gene: ENSMUSG00000049100
AA Change: G706S

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
low complexity region 887 896 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195655
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This family member contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein is a cadherin-related neuronal receptor thought to function in the establishment of specific cell-cell connections in the brain. This gene plays a role in inhibiting cancer cell motility and cell migration. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a reporter allele die within several weeks of birth and exhibit decreased body size and defective striatal axon growth and thalamocortical projections in the ventral telencephalon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,246,595 D710G probably damaging Het
Abca14 T A 7: 120,252,250 V817D probably damaging Het
Abca5 A G 11: 110,292,183 V1016A probably benign Het
Ano2 G T 6: 126,039,253 M916I possibly damaging Het
Aqr T C 2: 114,133,073 N632S probably damaging Het
Cd48 G A 1: 171,695,705 V39I possibly damaging Het
Cdk17 A G 10: 93,232,412 T344A probably damaging Het
Chd8 A T 14: 52,213,048 probably benign Het
Col4a1 A T 8: 11,312,550 probably benign Het
Col9a3 G A 2: 180,616,525 R579H probably damaging Het
Cyp2c69 T G 19: 39,851,159 Q340P probably null Het
D630003M21Rik T A 2: 158,217,021 T320S probably benign Het
D630045J12Rik A T 6: 38,196,847 S129T possibly damaging Het
Fam13a A T 6: 59,024,318 L8Q probably null Het
Fam83b T C 9: 76,545,599 N62S probably benign Het
Foxred1 A T 9: 35,209,970 V94E probably damaging Het
Gm1966 T A 7: 106,601,590 noncoding transcript Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gprc5a T C 6: 135,078,870 V105A probably damaging Het
Itga2 A T 13: 114,843,435 W1077R probably damaging Het
Kat6b A G 14: 21,669,264 D1228G probably damaging Het
Kctd3 A G 1: 188,981,366 Y391H probably damaging Het
Kdelr2 T A 5: 143,404,029 I23N probably damaging Het
Kmt2a A T 9: 44,841,038 probably benign Het
Lao1 A G 4: 118,967,369 E216G probably damaging Het
Mark4 G T 7: 19,429,607 probably null Het
Mcm10 A G 2: 4,992,118 W851R probably damaging Het
Mettl21e T C 1: 44,218,116 Y14C probably benign Het
Miga1 CACAACAACAACAACAACA CACAACAACAACAACA 3: 152,333,446 probably benign Het
Mmp20 A G 9: 7,643,957 probably null Het
Nlrp5 A T 7: 23,417,934 D361V probably benign Het
Nrip3 T C 7: 109,761,838 T210A probably damaging Het
Olfr102 T C 17: 37,313,668 T239A probably damaging Het
Olfr591 T C 7: 103,173,451 Y62C probably damaging Het
Pdzd2 G A 15: 12,382,676 P1197L probably benign Het
Pfkfb3 T C 2: 11,484,669 S273G probably benign Het
Pkn3 T C 2: 30,088,584 probably null Het
Rab40c G A 17: 25,890,669 T78I probably damaging Het
Rec8 A T 14: 55,622,826 Q291L probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sart3 A G 5: 113,771,380 W86R probably damaging Het
Slc6a11 A G 6: 114,243,894 D462G probably damaging Het
Syne2 A G 12: 75,888,172 T143A probably benign Het
Tardbp A G 4: 148,618,640 F289S probably benign Het
Tdgf1 G A 9: 110,943,197 R44C probably benign Het
Tdpoz1 T A 3: 93,670,667 Y270F possibly damaging Het
Tmem117 ACCC ACC 15: 95,094,817 probably null Het
Trim43a A T 9: 88,582,176 I47F probably damaging Het
Vim A T 2: 13,575,581 T202S probably benign Het
Vps13b A T 15: 35,770,542 I2044L probably benign Het
Wdr5 T G 2: 27,525,153 D192E probably damaging Het
Zmym2 A G 14: 56,956,255 K1176E possibly damaging Het
Other mutations in Pcdh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Pcdh10 APN 3 45380302 missense probably damaging 1.00
IGL01115:Pcdh10 APN 3 45392775 missense probably damaging 1.00
IGL01535:Pcdh10 APN 3 45379643 missense probably damaging 1.00
IGL01600:Pcdh10 APN 3 45379487 missense probably damaging 0.98
IGL01625:Pcdh10 APN 3 45379397 missense probably damaging 0.99
IGL01966:Pcdh10 APN 3 45380298 missense probably benign 0.05
IGL02232:Pcdh10 APN 3 45380942 missense probably benign 0.00
IGL02490:Pcdh10 APN 3 45380487 missense probably damaging 1.00
IGL02890:Pcdh10 APN 3 45392617 missense probably damaging 1.00
IGL02976:Pcdh10 APN 3 45380013 missense possibly damaging 0.92
IGL02997:Pcdh10 APN 3 45379362 missense probably damaging 1.00
IGL03006:Pcdh10 APN 3 45379502 missense probably damaging 0.99
IGL03385:Pcdh10 APN 3 45381512 missense possibly damaging 0.77
R0025:Pcdh10 UTSW 3 45380499 missense possibly damaging 0.93
R0157:Pcdh10 UTSW 3 45379701 missense probably damaging 1.00
R0372:Pcdh10 UTSW 3 45379497 missense probably damaging 1.00
R0652:Pcdh10 UTSW 3 45379764 missense probably damaging 1.00
R0760:Pcdh10 UTSW 3 45380570 missense probably benign 0.19
R0976:Pcdh10 UTSW 3 45380801 missense probably damaging 1.00
R1307:Pcdh10 UTSW 3 45381879 missense probably benign 0.00
R1466:Pcdh10 UTSW 3 45379974 missense probably damaging 1.00
R1466:Pcdh10 UTSW 3 45379974 missense probably damaging 1.00
R1510:Pcdh10 UTSW 3 45379403 missense probably damaging 1.00
R1619:Pcdh10 UTSW 3 45380312 missense possibly damaging 0.94
R1678:Pcdh10 UTSW 3 45381881 nonsense probably null
R1687:Pcdh10 UTSW 3 45380015 missense probably damaging 1.00
R1750:Pcdh10 UTSW 3 45381881 nonsense probably null
R1751:Pcdh10 UTSW 3 45384177 missense probably damaging 1.00
R1767:Pcdh10 UTSW 3 45384177 missense probably damaging 1.00
R1857:Pcdh10 UTSW 3 45379937 missense possibly damaging 0.86
R2086:Pcdh10 UTSW 3 45380471 missense probably damaging 0.98
R3960:Pcdh10 UTSW 3 45379314 missense probably benign
R4083:Pcdh10 UTSW 3 45392707 missense probably damaging 1.00
R4084:Pcdh10 UTSW 3 45392707 missense probably damaging 1.00
R4112:Pcdh10 UTSW 3 45381620 missense probably damaging 1.00
R4754:Pcdh10 UTSW 3 45380637 missense probably damaging 0.99
R4946:Pcdh10 UTSW 3 45379482 missense probably damaging 1.00
R5039:Pcdh10 UTSW 3 45381861 missense probably damaging 1.00
R5224:Pcdh10 UTSW 3 45392814 missense probably damaging 0.99
R5233:Pcdh10 UTSW 3 45384191 missense probably damaging 1.00
R5261:Pcdh10 UTSW 3 45381812 missense probably damaging 1.00
R5429:Pcdh10 UTSW 3 45384200 missense probably benign 0.00
R5558:Pcdh10 UTSW 3 45384168 missense probably damaging 1.00
R5784:Pcdh10 UTSW 3 45380640 missense probably damaging 1.00
R5815:Pcdh10 UTSW 3 45392721 missense probably benign 0.04
R6283:Pcdh10 UTSW 3 45381554 missense possibly damaging 0.46
R6396:Pcdh10 UTSW 3 45380060 missense possibly damaging 0.46
R6703:Pcdh10 UTSW 3 45381299 missense possibly damaging 0.87
R6756:Pcdh10 UTSW 3 45380106 missense possibly damaging 0.80
R6968:Pcdh10 UTSW 3 45379542 missense probably damaging 1.00
R7463:Pcdh10 UTSW 3 45383572 missense possibly damaging 0.59
X0013:Pcdh10 UTSW 3 45379566 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTCTTTCGACTGGACTGG -3'
(R):5'- CCAACATGATATCTGACTTGCTG -3'

Sequencing Primer
(F):5'- TTCGACTGGACTGGCGCAC -3'
(R):5'- CATGATATCTGACTTGCTGAGTTTC -3'
Posted On2016-10-05