Incidental Mutation 'R5488:Kdelr2'
ID430453
Institutional Source Beutler Lab
Gene Symbol Kdelr2
Ensembl Gene ENSMUSG00000079111
Gene NameKDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2
Synonyms
MMRRC Submission 043049-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.694) question?
Stock #R5488 (G1)
Quality Score96
Status Validated
Chromosome5
Chromosomal Location143403838-143421901 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 143404029 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 23 (I23N)
Ref Sequence ENSEMBL: ENSMUSP00000106359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110731]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000061947
Predicted Effect probably damaging
Transcript: ENSMUST00000110731
AA Change: I23N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106359
Gene: ENSMUSG00000079111
AA Change: I23N

DomainStartEndE-ValueType
Pfam:ER_lumen_recept 28 169 1.6e-57 PFAM
transmembrane domain 178 200 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197918
Meta Mutation Damage Score 0.686 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Retention of resident soluble proteins in the lumen of the endoplasmic reticulum (ER) is achieved in both yeast and animal cells by their continual retrieval from the cis-Golgi, or a pre-Golgi compartment. Sorting of these proteins is dependent on a C-terminal tetrapeptide signal, usually lys-asp-glu-leu (KDEL) in animal cells, and his-asp-glu-leu (HDEL) in S. cerevisiae. This process is mediated by a receptor that recognizes, and binds the tetrapeptide-containing protein, and returns it to the ER. In yeast, the sorting receptor encoded by a single gene, ERD2, is a seven-transmembrane protein. Unlike yeast, several human homologs of the ERD2 gene, constituting the KDEL receptor gene family, have been described. KDELR2 was the second member of the family to be identified, and it encodes a protein which is 83% identical to the KDELR1 gene product. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,246,595 D710G probably damaging Het
Abca14 T A 7: 120,252,250 V817D probably damaging Het
Abca5 A G 11: 110,292,183 V1016A probably benign Het
Ano2 G T 6: 126,039,253 M916I possibly damaging Het
Aqr T C 2: 114,133,073 N632S probably damaging Het
Cd48 G A 1: 171,695,705 V39I possibly damaging Het
Cdk17 A G 10: 93,232,412 T344A probably damaging Het
Chd8 A T 14: 52,213,048 probably benign Het
Col4a1 A T 8: 11,312,550 probably benign Het
Col9a3 G A 2: 180,616,525 R579H probably damaging Het
Cyp2c69 T G 19: 39,851,159 Q340P probably null Het
D630003M21Rik T A 2: 158,217,021 T320S probably benign Het
D630045J12Rik A T 6: 38,196,847 S129T possibly damaging Het
Fam13a A T 6: 59,024,318 L8Q probably null Het
Fam83b T C 9: 76,545,599 N62S probably benign Het
Foxred1 A T 9: 35,209,970 V94E probably damaging Het
Gm1966 T A 7: 106,601,590 noncoding transcript Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gprc5a T C 6: 135,078,870 V105A probably damaging Het
Itga2 A T 13: 114,843,435 W1077R probably damaging Het
Kat6b A G 14: 21,669,264 D1228G probably damaging Het
Kctd3 A G 1: 188,981,366 Y391H probably damaging Het
Kmt2a A T 9: 44,841,038 probably benign Het
Lao1 A G 4: 118,967,369 E216G probably damaging Het
Mark4 G T 7: 19,429,607 probably null Het
Mcm10 A G 2: 4,992,118 W851R probably damaging Het
Mettl21e T C 1: 44,218,116 Y14C probably benign Het
Miga1 CACAACAACAACAACAACA CACAACAACAACAACA 3: 152,333,446 probably benign Het
Mmp20 A G 9: 7,643,957 probably null Het
Nlrp5 A T 7: 23,417,934 D361V probably benign Het
Nrip3 T C 7: 109,761,838 T210A probably damaging Het
Olfr102 T C 17: 37,313,668 T239A probably damaging Het
Olfr591 T C 7: 103,173,451 Y62C probably damaging Het
Pcdh10 G A 3: 45,381,368 G706S probably damaging Het
Pdzd2 G A 15: 12,382,676 P1197L probably benign Het
Pfkfb3 T C 2: 11,484,669 S273G probably benign Het
Pkn3 T C 2: 30,088,584 probably null Het
Rab40c G A 17: 25,890,669 T78I probably damaging Het
Rec8 A T 14: 55,622,826 Q291L probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sart3 A G 5: 113,771,380 W86R probably damaging Het
Slc6a11 A G 6: 114,243,894 D462G probably damaging Het
Syne2 A G 12: 75,888,172 T143A probably benign Het
Tardbp A G 4: 148,618,640 F289S probably benign Het
Tdgf1 G A 9: 110,943,197 R44C probably benign Het
Tdpoz1 T A 3: 93,670,667 Y270F possibly damaging Het
Tmem117 ACCC ACC 15: 95,094,817 probably null Het
Trim43a A T 9: 88,582,176 I47F probably damaging Het
Vim A T 2: 13,575,581 T202S probably benign Het
Vps13b A T 15: 35,770,542 I2044L probably benign Het
Wdr5 T G 2: 27,525,153 D192E probably damaging Het
Zmym2 A G 14: 56,956,255 K1176E possibly damaging Het
Other mutations in Kdelr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Kdelr2 APN 5 143412575 missense probably damaging 1.00
IGL01961:Kdelr2 APN 5 143420801 missense probably benign 0.01
IGL03220:Kdelr2 APN 5 143418115 nonsense probably null
fennel UTSW 5 143412517 missense probably damaging 0.98
R0319:Kdelr2 UTSW 5 143412517 missense probably damaging 0.98
R1765:Kdelr2 UTSW 5 143420812 nonsense probably null
R5424:Kdelr2 UTSW 5 143418144 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGTAAAGTCCGGCTGCTCAC -3'
(R):5'- TTTTCAGATGCAGCAGGACG -3'

Sequencing Primer
(F):5'- ACCGACGCTGGGCCTTTAAG -3'
(R):5'- ACGGATCAAGTTCGCGAGC -3'
Posted On2016-10-05