Incidental Mutation 'R5488:Kdelr2'
ID 430453
Institutional Source Beutler Lab
Gene Symbol Kdelr2
Ensembl Gene ENSMUSG00000079111
Gene Name KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2
Synonyms 1110007A14Rik
MMRRC Submission 043049-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.726) question?
Stock # R5488 (G1)
Quality Score 96
Status Validated
Chromosome 5
Chromosomal Location 143389593-143407656 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 143389784 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 23 (I23N)
Ref Sequence ENSEMBL: ENSMUSP00000106359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110731]
AlphaFold Q9CQM2
Predicted Effect noncoding transcript
Transcript: ENSMUST00000061947
Predicted Effect probably damaging
Transcript: ENSMUST00000110731
AA Change: I23N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106359
Gene: ENSMUSG00000079111
AA Change: I23N

DomainStartEndE-ValueType
Pfam:ER_lumen_recept 28 169 1.6e-57 PFAM
transmembrane domain 178 200 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197918
Meta Mutation Damage Score 0.9631 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Retention of resident soluble proteins in the lumen of the endoplasmic reticulum (ER) is achieved in both yeast and animal cells by their continual retrieval from the cis-Golgi, or a pre-Golgi compartment. Sorting of these proteins is dependent on a C-terminal tetrapeptide signal, usually lys-asp-glu-leu (KDEL) in animal cells, and his-asp-glu-leu (HDEL) in S. cerevisiae. This process is mediated by a receptor that recognizes, and binds the tetrapeptide-containing protein, and returns it to the ER. In yeast, the sorting receptor encoded by a single gene, ERD2, is a seven-transmembrane protein. Unlike yeast, several human homologs of the ERD2 gene, constituting the KDEL receptor gene family, have been described. KDELR2 was the second member of the family to be identified, and it encodes a protein which is 83% identical to the KDELR1 gene product. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 119,851,473 (GRCm39) V817D probably damaging Het
Abca5 A G 11: 110,183,009 (GRCm39) V1016A probably benign Het
Ano2 G T 6: 126,016,216 (GRCm39) M916I possibly damaging Het
Aqr T C 2: 113,963,554 (GRCm39) N632S probably damaging Het
Cd48 G A 1: 171,523,273 (GRCm39) V39I possibly damaging Het
Cdcp3 A G 7: 130,848,324 (GRCm39) D710G probably damaging Het
Cdk17 A G 10: 93,068,274 (GRCm39) T344A probably damaging Het
Chd8 A T 14: 52,450,505 (GRCm39) probably benign Het
Col4a1 A T 8: 11,362,550 (GRCm39) probably benign Het
Col9a3 G A 2: 180,258,318 (GRCm39) R579H probably damaging Het
Cripto G A 9: 110,772,265 (GRCm39) R44C probably benign Het
Cyp2c69 T G 19: 39,839,603 (GRCm39) Q340P probably null Het
D630003M21Rik T A 2: 158,058,941 (GRCm39) T320S probably benign Het
D630045J12Rik A T 6: 38,173,782 (GRCm39) S129T possibly damaging Het
Eif4a3l1 C G 6: 136,306,555 (GRCm39) R339G probably damaging Het
Fam13a A T 6: 59,001,303 (GRCm39) L8Q probably null Het
Fam83b T C 9: 76,452,881 (GRCm39) N62S probably benign Het
Foxred1 A T 9: 35,121,266 (GRCm39) V94E probably damaging Het
Gprc5a T C 6: 135,055,868 (GRCm39) V105A probably damaging Het
Gvin3 T A 7: 106,200,797 (GRCm39) noncoding transcript Het
Itga2 A T 13: 114,979,971 (GRCm39) W1077R probably damaging Het
Kat6b A G 14: 21,719,332 (GRCm39) D1228G probably damaging Het
Kctd3 A G 1: 188,713,563 (GRCm39) Y391H probably damaging Het
Kmt2a A T 9: 44,752,335 (GRCm39) probably benign Het
Lao1 A G 4: 118,824,566 (GRCm39) E216G probably damaging Het
Mark4 G T 7: 19,163,532 (GRCm39) probably null Het
Mcm10 A G 2: 4,996,929 (GRCm39) W851R probably damaging Het
Mettl21e T C 1: 44,257,276 (GRCm39) Y14C probably benign Het
Miga1 CACAACAACAACAACAACA CACAACAACAACAACA 3: 152,039,083 (GRCm39) probably benign Het
Mmp20 A G 9: 7,643,958 (GRCm39) probably null Het
Nlrp5 A T 7: 23,117,359 (GRCm39) D361V probably benign Het
Nrip3 T C 7: 109,361,045 (GRCm39) T210A probably damaging Het
Or12d2 T C 17: 37,624,559 (GRCm39) T239A probably damaging Het
Or52s1b T C 7: 102,822,658 (GRCm39) Y62C probably damaging Het
Pcdh10 G A 3: 45,335,803 (GRCm39) G706S probably damaging Het
Pdzd2 G A 15: 12,382,762 (GRCm39) P1197L probably benign Het
Pfkfb3 T C 2: 11,489,480 (GRCm39) S273G probably benign Het
Pkn3 T C 2: 29,978,596 (GRCm39) probably null Het
Rab40c G A 17: 26,109,643 (GRCm39) T78I probably damaging Het
Rec8 A T 14: 55,860,283 (GRCm39) Q291L probably benign Het
Robo4 CGG CG 9: 37,322,786 (GRCm39) probably null Het
Sart3 A G 5: 113,909,441 (GRCm39) W86R probably damaging Het
Slc6a11 A G 6: 114,220,855 (GRCm39) D462G probably damaging Het
Syne2 A G 12: 75,934,946 (GRCm39) T143A probably benign Het
Tardbp A G 4: 148,703,097 (GRCm39) F289S probably benign Het
Tdpoz1 T A 3: 93,577,974 (GRCm39) Y270F possibly damaging Het
Tmem117 ACCC ACC 15: 94,992,698 (GRCm39) probably null Het
Trim43a A T 9: 88,464,229 (GRCm39) I47F probably damaging Het
Vim A T 2: 13,580,392 (GRCm39) T202S probably benign Het
Vps13b A T 15: 35,770,688 (GRCm39) I2044L probably benign Het
Wdr5 T G 2: 27,415,165 (GRCm39) D192E probably damaging Het
Zmym2 A G 14: 57,193,712 (GRCm39) K1176E possibly damaging Het
Other mutations in Kdelr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Kdelr2 APN 5 143,398,330 (GRCm39) missense probably damaging 1.00
IGL01961:Kdelr2 APN 5 143,406,556 (GRCm39) missense probably benign 0.01
IGL03220:Kdelr2 APN 5 143,403,870 (GRCm39) nonsense probably null
fennel UTSW 5 143,398,272 (GRCm39) missense probably damaging 0.98
R0319:Kdelr2 UTSW 5 143,398,272 (GRCm39) missense probably damaging 0.98
R1765:Kdelr2 UTSW 5 143,406,567 (GRCm39) nonsense probably null
R5424:Kdelr2 UTSW 5 143,403,899 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGTAAAGTCCGGCTGCTCAC -3'
(R):5'- TTTTCAGATGCAGCAGGACG -3'

Sequencing Primer
(F):5'- ACCGACGCTGGGCCTTTAAG -3'
(R):5'- ACGGATCAAGTTCGCGAGC -3'
Posted On 2016-10-05