Incidental Mutation 'R5488:Slc6a11'
ID430456
Institutional Source Beutler Lab
Gene Symbol Slc6a11
Ensembl Gene ENSMUSG00000030307
Gene Namesolute carrier family 6 (neurotransmitter transporter, GABA), member 11
SynonymsGabt4, E130202I16Rik, Gat3, D930045G19Rik, GAT4
MMRRC Submission 043049-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5488 (G1)
Quality Score126
Status Validated
Chromosome6
Chromosomal Location114131241-114249952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114243894 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 462 (D462G)
Ref Sequence ENSEMBL: ENSMUSP00000032451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032451]
Predicted Effect probably damaging
Transcript: ENSMUST00000032451
AA Change: D462G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032451
Gene: ENSMUSG00000030307
AA Change: D462G

DomainStartEndE-ValueType
low complexity region 25 33 N/A INTRINSIC
Pfam:SNF 45 571 4.1e-250 PFAM
Meta Mutation Damage Score 0.642 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-dependent transporter that uptakes gamma-aminobutyric acid (GABA), an inhibitory neurotransmitter, which ends the GABA neurotransmission. Defects in this gene may result in epilepsy, behavioral problems, or intellectual problems. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a targeted mutation display postnatal lethality. Mice heterozygous for a targeted mutation display resistance to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,246,595 D710G probably damaging Het
Abca14 T A 7: 120,252,250 V817D probably damaging Het
Abca5 A G 11: 110,292,183 V1016A probably benign Het
Ano2 G T 6: 126,039,253 M916I possibly damaging Het
Aqr T C 2: 114,133,073 N632S probably damaging Het
Cd48 G A 1: 171,695,705 V39I possibly damaging Het
Cdk17 A G 10: 93,232,412 T344A probably damaging Het
Chd8 A T 14: 52,213,048 probably benign Het
Col4a1 A T 8: 11,312,550 probably benign Het
Col9a3 G A 2: 180,616,525 R579H probably damaging Het
Cyp2c69 T G 19: 39,851,159 Q340P probably null Het
D630003M21Rik T A 2: 158,217,021 T320S probably benign Het
D630045J12Rik A T 6: 38,196,847 S129T possibly damaging Het
Fam13a A T 6: 59,024,318 L8Q probably null Het
Fam83b T C 9: 76,545,599 N62S probably benign Het
Foxred1 A T 9: 35,209,970 V94E probably damaging Het
Gm1966 T A 7: 106,601,590 noncoding transcript Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gprc5a T C 6: 135,078,870 V105A probably damaging Het
Itga2 A T 13: 114,843,435 W1077R probably damaging Het
Kat6b A G 14: 21,669,264 D1228G probably damaging Het
Kctd3 A G 1: 188,981,366 Y391H probably damaging Het
Kdelr2 T A 5: 143,404,029 I23N probably damaging Het
Kmt2a A T 9: 44,841,038 probably benign Het
Lao1 A G 4: 118,967,369 E216G probably damaging Het
Mark4 G T 7: 19,429,607 probably null Het
Mcm10 A G 2: 4,992,118 W851R probably damaging Het
Mettl21e T C 1: 44,218,116 Y14C probably benign Het
Miga1 CACAACAACAACAACAACA CACAACAACAACAACA 3: 152,333,446 probably benign Het
Mmp20 A G 9: 7,643,957 probably null Het
Nlrp5 A T 7: 23,417,934 D361V probably benign Het
Nrip3 T C 7: 109,761,838 T210A probably damaging Het
Olfr102 T C 17: 37,313,668 T239A probably damaging Het
Olfr591 T C 7: 103,173,451 Y62C probably damaging Het
Pcdh10 G A 3: 45,381,368 G706S probably damaging Het
Pdzd2 G A 15: 12,382,676 P1197L probably benign Het
Pfkfb3 T C 2: 11,484,669 S273G probably benign Het
Pkn3 T C 2: 30,088,584 probably null Het
Rab40c G A 17: 25,890,669 T78I probably damaging Het
Rec8 A T 14: 55,622,826 Q291L probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sart3 A G 5: 113,771,380 W86R probably damaging Het
Syne2 A G 12: 75,888,172 T143A probably benign Het
Tardbp A G 4: 148,618,640 F289S probably benign Het
Tdgf1 G A 9: 110,943,197 R44C probably benign Het
Tdpoz1 T A 3: 93,670,667 Y270F possibly damaging Het
Tmem117 ACCC ACC 15: 95,094,817 probably null Het
Trim43a A T 9: 88,582,176 I47F probably damaging Het
Vim A T 2: 13,575,581 T202S probably benign Het
Vps13b A T 15: 35,770,542 I2044L probably benign Het
Wdr5 T G 2: 27,525,153 D192E probably damaging Het
Zmym2 A G 14: 56,956,255 K1176E possibly damaging Het
Other mutations in Slc6a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Slc6a11 APN 6 114134665 missense probably damaging 1.00
IGL01306:Slc6a11 APN 6 114134665 missense probably damaging 1.00
IGL01308:Slc6a11 APN 6 114134665 missense probably damaging 1.00
IGL01616:Slc6a11 APN 6 114134868 missense possibly damaging 0.93
IGL01985:Slc6a11 APN 6 114134892 missense probably benign 0.43
IGL02270:Slc6a11 APN 6 114238396 missense probably damaging 1.00
IGL02692:Slc6a11 APN 6 114162139 missense probably damaging 1.00
IGL02828:Slc6a11 APN 6 114134987 missense possibly damaging 0.53
IGL03135:Slc6a11 APN 6 114194609 critical splice acceptor site probably null
ANU23:Slc6a11 UTSW 6 114134665 missense probably damaging 1.00
R0603:Slc6a11 UTSW 6 114244890 missense probably benign 0.03
R1147:Slc6a11 UTSW 6 114244870 missense possibly damaging 0.90
R1147:Slc6a11 UTSW 6 114244870 missense possibly damaging 0.90
R1219:Slc6a11 UTSW 6 114225811 splice site probably benign
R1226:Slc6a11 UTSW 6 114194663 missense possibly damaging 0.93
R1676:Slc6a11 UTSW 6 114247666 missense probably benign
R2231:Slc6a11 UTSW 6 114194629 missense probably damaging 1.00
R2297:Slc6a11 UTSW 6 114131425 missense probably benign 0.37
R4384:Slc6a11 UTSW 6 114247727 missense possibly damaging 0.47
R4556:Slc6a11 UTSW 6 114244812 missense probably benign 0.00
R4564:Slc6a11 UTSW 6 114131362 missense probably benign 0.00
R5736:Slc6a11 UTSW 6 114162162 missense probably damaging 1.00
R6021:Slc6a11 UTSW 6 114230051 missense probably damaging 1.00
R6150:Slc6a11 UTSW 6 114245618 missense probably benign 0.08
R6733:Slc6a11 UTSW 6 114134898 missense probably damaging 1.00
R7391:Slc6a11 UTSW 6 114238461 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATGACATCTCGGCAGGACAGG -3'
(R):5'- TCCTATGCTGGCACAAAACC -3'

Sequencing Primer
(F):5'- GACAGGGCCTTGGAAAACCC -3'
(R):5'- CACAAAACCAGGAAGATCTTGTG -3'
Posted On2016-10-05