Incidental Mutation 'R5488:Gm8994'
ID430459
Institutional Source Beutler Lab
Gene Symbol Gm8994
Ensembl Gene ENSMUSG00000094973
Gene Namepredicted gene 8994
Synonyms
MMRRC Submission 043049-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock #R5488 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location136327539-136329983 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 136329557 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 339 (R339G)
Ref Sequence ENSEMBL: ENSMUSP00000144809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077886] [ENSMUST00000204530] [ENSMUST00000204966]
Predicted Effect probably damaging
Transcript: ENSMUST00000077886
AA Change: R339G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133154
Gene: ENSMUSG00000094973
AA Change: R339G

DomainStartEndE-ValueType
DEXDc 57 254 4.55e-57 SMART
HELICc 291 372 1.63e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204530
AA Change: R339G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144809
Gene: ENSMUSG00000094973
AA Change: R339G

DomainStartEndE-ValueType
DEXDc 57 254 4.55e-57 SMART
HELICc 291 372 1.63e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204966
SMART Domains Protein: ENSMUSP00000145166
Gene: ENSMUSG00000094973

DomainStartEndE-ValueType
DEXDc 57 233 1.8e-41 SMART
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,246,595 D710G probably damaging Het
Abca14 T A 7: 120,252,250 V817D probably damaging Het
Abca5 A G 11: 110,292,183 V1016A probably benign Het
Ano2 G T 6: 126,039,253 M916I possibly damaging Het
Aqr T C 2: 114,133,073 N632S probably damaging Het
Cd48 G A 1: 171,695,705 V39I possibly damaging Het
Cdk17 A G 10: 93,232,412 T344A probably damaging Het
Chd8 A T 14: 52,213,048 probably benign Het
Col4a1 A T 8: 11,312,550 probably benign Het
Col9a3 G A 2: 180,616,525 R579H probably damaging Het
Cyp2c69 T G 19: 39,851,159 Q340P probably null Het
D630003M21Rik T A 2: 158,217,021 T320S probably benign Het
D630045J12Rik A T 6: 38,196,847 S129T possibly damaging Het
Fam13a A T 6: 59,024,318 L8Q probably null Het
Fam83b T C 9: 76,545,599 N62S probably benign Het
Foxred1 A T 9: 35,209,970 V94E probably damaging Het
Gm1966 T A 7: 106,601,590 noncoding transcript Het
Gprc5a T C 6: 135,078,870 V105A probably damaging Het
Itga2 A T 13: 114,843,435 W1077R probably damaging Het
Kat6b A G 14: 21,669,264 D1228G probably damaging Het
Kctd3 A G 1: 188,981,366 Y391H probably damaging Het
Kdelr2 T A 5: 143,404,029 I23N probably damaging Het
Kmt2a A T 9: 44,841,038 probably benign Het
Lao1 A G 4: 118,967,369 E216G probably damaging Het
Mark4 G T 7: 19,429,607 probably null Het
Mcm10 A G 2: 4,992,118 W851R probably damaging Het
Mettl21e T C 1: 44,218,116 Y14C probably benign Het
Miga1 CACAACAACAACAACAACA CACAACAACAACAACA 3: 152,333,446 probably benign Het
Mmp20 A G 9: 7,643,957 probably null Het
Nlrp5 A T 7: 23,417,934 D361V probably benign Het
Nrip3 T C 7: 109,761,838 T210A probably damaging Het
Olfr102 T C 17: 37,313,668 T239A probably damaging Het
Olfr591 T C 7: 103,173,451 Y62C probably damaging Het
Pcdh10 G A 3: 45,381,368 G706S probably damaging Het
Pdzd2 G A 15: 12,382,676 P1197L probably benign Het
Pfkfb3 T C 2: 11,484,669 S273G probably benign Het
Pkn3 T C 2: 30,088,584 probably null Het
Rab40c G A 17: 25,890,669 T78I probably damaging Het
Rec8 A T 14: 55,622,826 Q291L probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sart3 A G 5: 113,771,380 W86R probably damaging Het
Slc6a11 A G 6: 114,243,894 D462G probably damaging Het
Syne2 A G 12: 75,888,172 T143A probably benign Het
Tardbp A G 4: 148,618,640 F289S probably benign Het
Tdgf1 G A 9: 110,943,197 R44C probably benign Het
Tdpoz1 T A 3: 93,670,667 Y270F possibly damaging Het
Tmem117 ACCC ACC 15: 95,094,817 probably null Het
Trim43a A T 9: 88,582,176 I47F probably damaging Het
Vim A T 2: 13,575,581 T202S probably benign Het
Vps13b A T 15: 35,770,542 I2044L probably benign Het
Wdr5 T G 2: 27,525,153 D192E probably damaging Het
Zmym2 A G 14: 56,956,255 K1176E possibly damaging Het
Other mutations in Gm8994
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Gm8994 APN 6 136329111 missense probably damaging 1.00
IGL02480:Gm8994 APN 6 136329215 missense probably damaging 1.00
IGL03048:Gm8994 UTSW 6 136329200 missense probably damaging 1.00
R0153:Gm8994 UTSW 6 136328844 missense probably damaging 0.99
R1602:Gm8994 UTSW 6 136328780 missense probably damaging 0.98
R2258:Gm8994 UTSW 6 136328561 missense probably benign 0.00
R3915:Gm8994 UTSW 6 136329422 missense probably benign 0.04
R4898:Gm8994 UTSW 6 136328739 missense possibly damaging 0.60
R4902:Gm8994 UTSW 6 136329264 missense probably benign 0.42
R5349:Gm8994 UTSW 6 136329696 missense probably damaging 1.00
R5491:Gm8994 UTSW 6 136329557 missense probably damaging 1.00
R5493:Gm8994 UTSW 6 136329557 missense probably damaging 1.00
R5494:Gm8994 UTSW 6 136329557 missense probably damaging 1.00
R5548:Gm8994 UTSW 6 136329570 missense probably damaging 0.99
R5668:Gm8994 UTSW 6 136329395 missense probably benign 0.00
R5998:Gm8994 UTSW 6 136328624 missense probably benign 0.23
R6393:Gm8994 UTSW 6 136328598 missense probably benign
R6898:Gm8994 UTSW 6 136328619 missense probably benign 0.10
R7180:Gm8994 UTSW 6 136329537 missense probably damaging 1.00
R7193:Gm8994 UTSW 6 136329215 missense probably damaging 1.00
R7274:Gm8994 UTSW 6 136329398 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TCTCTACGACACGCTGACCATC -3'
(R):5'- TGGGCATCTCGTCTATCTGG -3'

Sequencing Primer
(F):5'- TCACCCAGGCCGTCATC -3'
(R):5'- CATCTCGTCTATCTGGGTGGAG -3'
Posted On2016-10-05