Incidental Mutation 'R5488:Olfr591'
ID430462
Institutional Source Beutler Lab
Gene Symbol Olfr591
Ensembl Gene ENSMUSG00000057461
Gene Nameolfactory receptor 591
SynonymsMOR24-1P, GA_x6K02T2PBJ9-5889409-5888465
MMRRC Submission 043049-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R5488 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103167074-103178340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103173451 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 62 (Y62C)
Ref Sequence ENSEMBL: ENSMUSP00000150894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074272] [ENSMUST00000216581]
Predicted Effect probably damaging
Transcript: ENSMUST00000074272
AA Change: Y62C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073884
Gene: ENSMUSG00000057461
AA Change: Y62C

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 9.4e-105 PFAM
Pfam:7TM_GPCR_Srsx 37 255 7.1e-8 PFAM
Pfam:7tm_1 43 294 6.9e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216581
AA Change: Y62C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218115
Meta Mutation Damage Score 0.0248 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,246,595 D710G probably damaging Het
Abca14 T A 7: 120,252,250 V817D probably damaging Het
Abca5 A G 11: 110,292,183 V1016A probably benign Het
Ano2 G T 6: 126,039,253 M916I possibly damaging Het
Aqr T C 2: 114,133,073 N632S probably damaging Het
Cd48 G A 1: 171,695,705 V39I possibly damaging Het
Cdk17 A G 10: 93,232,412 T344A probably damaging Het
Chd8 A T 14: 52,213,048 probably benign Het
Col4a1 A T 8: 11,312,550 probably benign Het
Col9a3 G A 2: 180,616,525 R579H probably damaging Het
Cyp2c69 T G 19: 39,851,159 Q340P probably null Het
D630003M21Rik T A 2: 158,217,021 T320S probably benign Het
D630045J12Rik A T 6: 38,196,847 S129T possibly damaging Het
Fam13a A T 6: 59,024,318 L8Q probably null Het
Fam83b T C 9: 76,545,599 N62S probably benign Het
Foxred1 A T 9: 35,209,970 V94E probably damaging Het
Gm1966 T A 7: 106,601,590 noncoding transcript Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gprc5a T C 6: 135,078,870 V105A probably damaging Het
Itga2 A T 13: 114,843,435 W1077R probably damaging Het
Kat6b A G 14: 21,669,264 D1228G probably damaging Het
Kctd3 A G 1: 188,981,366 Y391H probably damaging Het
Kdelr2 T A 5: 143,404,029 I23N probably damaging Het
Kmt2a A T 9: 44,841,038 probably benign Het
Lao1 A G 4: 118,967,369 E216G probably damaging Het
Mark4 G T 7: 19,429,607 probably null Het
Mcm10 A G 2: 4,992,118 W851R probably damaging Het
Mettl21e T C 1: 44,218,116 Y14C probably benign Het
Miga1 CACAACAACAACAACAACA CACAACAACAACAACA 3: 152,333,446 probably benign Het
Mmp20 A G 9: 7,643,957 probably null Het
Nlrp5 A T 7: 23,417,934 D361V probably benign Het
Nrip3 T C 7: 109,761,838 T210A probably damaging Het
Olfr102 T C 17: 37,313,668 T239A probably damaging Het
Pcdh10 G A 3: 45,381,368 G706S probably damaging Het
Pdzd2 G A 15: 12,382,676 P1197L probably benign Het
Pfkfb3 T C 2: 11,484,669 S273G probably benign Het
Pkn3 T C 2: 30,088,584 probably null Het
Rab40c G A 17: 25,890,669 T78I probably damaging Het
Rec8 A T 14: 55,622,826 Q291L probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sart3 A G 5: 113,771,380 W86R probably damaging Het
Slc6a11 A G 6: 114,243,894 D462G probably damaging Het
Syne2 A G 12: 75,888,172 T143A probably benign Het
Tardbp A G 4: 148,618,640 F289S probably benign Het
Tdgf1 G A 9: 110,943,197 R44C probably benign Het
Tdpoz1 T A 3: 93,670,667 Y270F possibly damaging Het
Tmem117 ACCC ACC 15: 95,094,817 probably null Het
Trim43a A T 9: 88,582,176 I47F probably damaging Het
Vim A T 2: 13,575,581 T202S probably benign Het
Vps13b A T 15: 35,770,542 I2044L probably benign Het
Wdr5 T G 2: 27,525,153 D192E probably damaging Het
Zmym2 A G 14: 56,956,255 K1176E possibly damaging Het
Other mutations in Olfr591
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02408:Olfr591 APN 7 103173451 missense probably damaging 1.00
IGL03307:Olfr591 APN 7 103173416 missense probably benign 0.00
R0082:Olfr591 UTSW 7 103173202 missense probably benign 0.05
R0389:Olfr591 UTSW 7 103173283 missense possibly damaging 0.48
R0843:Olfr591 UTSW 7 103173119 missense possibly damaging 0.74
R1378:Olfr591 UTSW 7 103173268 missense probably damaging 1.00
R1386:Olfr591 UTSW 7 103173367 missense probably benign 0.11
R1521:Olfr591 UTSW 7 103173451 missense probably benign 0.39
R1538:Olfr591 UTSW 7 103172986 missense probably damaging 0.97
R3108:Olfr591 UTSW 7 103173086 missense probably damaging 0.98
R3109:Olfr591 UTSW 7 103173086 missense probably damaging 0.98
R5350:Olfr591 UTSW 7 103173559 missense probably damaging 0.99
R5489:Olfr591 UTSW 7 103173451 missense probably damaging 1.00
R5598:Olfr591 UTSW 7 103173634 start codon destroyed probably null 1.00
R5607:Olfr591 UTSW 7 103172849 missense probably damaging 0.96
R5608:Olfr591 UTSW 7 103172849 missense probably damaging 0.96
R6974:Olfr591 UTSW 7 103173235 missense probably damaging 0.99
R6994:Olfr591 UTSW 7 103172912 missense probably damaging 1.00
R7095:Olfr591 UTSW 7 103173046 missense probably benign 0.00
Z1088:Olfr591 UTSW 7 103172806 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGCTACATAACGGTCAAAGGCC -3'
(R):5'- CCACAAACTTTTGACACTCATCATG -3'

Sequencing Primer
(F):5'- GGTCAAAGGCCATTCCTACAAGG -3'
(R):5'- AAACTTTTGACACTCATCATGTTAAC -3'
Posted On2016-10-05