Incidental Mutation 'R5488:Gm1966'
ID430463
Institutional Source Beutler Lab
Gene Symbol Gm1966
Ensembl Gene ENSMUSG00000073902
Gene Namepredicted gene 1966
Synonyms
MMRRC Submission 043049-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R5488 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location106596743-106604035 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to A at 106601590 bp
ZygosityHeterozygous
Amino Acid Change
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184540
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,246,595 D710G probably damaging Het
Abca14 T A 7: 120,252,250 V817D probably damaging Het
Abca5 A G 11: 110,292,183 V1016A probably benign Het
Ano2 G T 6: 126,039,253 M916I possibly damaging Het
Aqr T C 2: 114,133,073 N632S probably damaging Het
Cd48 G A 1: 171,695,705 V39I possibly damaging Het
Cdk17 A G 10: 93,232,412 T344A probably damaging Het
Chd8 A T 14: 52,213,048 probably benign Het
Col4a1 A T 8: 11,312,550 probably benign Het
Col9a3 G A 2: 180,616,525 R579H probably damaging Het
Cyp2c69 T G 19: 39,851,159 Q340P probably null Het
D630003M21Rik T A 2: 158,217,021 T320S probably benign Het
D630045J12Rik A T 6: 38,196,847 S129T possibly damaging Het
Fam13a A T 6: 59,024,318 L8Q probably null Het
Fam83b T C 9: 76,545,599 N62S probably benign Het
Foxred1 A T 9: 35,209,970 V94E probably damaging Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gprc5a T C 6: 135,078,870 V105A probably damaging Het
Itga2 A T 13: 114,843,435 W1077R probably damaging Het
Kat6b A G 14: 21,669,264 D1228G probably damaging Het
Kctd3 A G 1: 188,981,366 Y391H probably damaging Het
Kdelr2 T A 5: 143,404,029 I23N probably damaging Het
Kmt2a A T 9: 44,841,038 probably benign Het
Lao1 A G 4: 118,967,369 E216G probably damaging Het
Mark4 G T 7: 19,429,607 probably null Het
Mcm10 A G 2: 4,992,118 W851R probably damaging Het
Mettl21e T C 1: 44,218,116 Y14C probably benign Het
Miga1 CACAACAACAACAACAACA CACAACAACAACAACA 3: 152,333,446 probably benign Het
Mmp20 A G 9: 7,643,957 probably null Het
Nlrp5 A T 7: 23,417,934 D361V probably benign Het
Nrip3 T C 7: 109,761,838 T210A probably damaging Het
Olfr102 T C 17: 37,313,668 T239A probably damaging Het
Olfr591 T C 7: 103,173,451 Y62C probably damaging Het
Pcdh10 G A 3: 45,381,368 G706S probably damaging Het
Pdzd2 G A 15: 12,382,676 P1197L probably benign Het
Pfkfb3 T C 2: 11,484,669 S273G probably benign Het
Pkn3 T C 2: 30,088,584 probably null Het
Rab40c G A 17: 25,890,669 T78I probably damaging Het
Rec8 A T 14: 55,622,826 Q291L probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sart3 A G 5: 113,771,380 W86R probably damaging Het
Slc6a11 A G 6: 114,243,894 D462G probably damaging Het
Syne2 A G 12: 75,888,172 T143A probably benign Het
Tardbp A G 4: 148,618,640 F289S probably benign Het
Tdgf1 G A 9: 110,943,197 R44C probably benign Het
Tdpoz1 T A 3: 93,670,667 Y270F possibly damaging Het
Tmem117 ACCC ACC 15: 95,094,817 probably null Het
Trim43a A T 9: 88,582,176 I47F probably damaging Het
Vim A T 2: 13,575,581 T202S probably benign Het
Vps13b A T 15: 35,770,542 I2044L probably benign Het
Wdr5 T G 2: 27,525,153 D192E probably damaging Het
Zmym2 A G 14: 56,956,255 K1176E possibly damaging Het
Other mutations in Gm1966
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Gm1966 APN 7 106602035 missense probably benign 0.10
IGL01410:Gm1966 APN 7 106603051 exon noncoding transcript
IGL01415:Gm1966 APN 7 106603051 exon noncoding transcript
IGL01538:Gm1966 APN 7 106602537 missense probably damaging 0.96
IGL01751:Gm1966 APN 7 106602309 missense possibly damaging 0.80
IGL01916:Gm1966 APN 7 106601826 missense probably benign 0.28
IGL02171:Gm1966 APN 7 106601341 exon noncoding transcript
IGL02550:Gm1966 APN 7 106601639 exon noncoding transcript
H8562:Gm1966 UTSW 7 106603149 missense probably damaging 1.00
R0016:Gm1966 UTSW 7 106603246 missense probably benign 0.00
R0178:Gm1966 UTSW 7 106601821 missense probably damaging 1.00
R0420:Gm1966 UTSW 7 106603883 missense probably damaging 1.00
R0658:Gm1966 UTSW 7 106602886 missense possibly damaging 0.89
R1378:Gm1966 UTSW 7 106602166 missense probably damaging 0.97
R1506:Gm1966 UTSW 7 106601581 missense probably benign 0.08
R1628:Gm1966 UTSW 7 106603269 nonsense probably null
R1834:Gm1966 UTSW 7 106603776 missense possibly damaging 0.79
R1888:Gm1966 UTSW 7 106597423 exon noncoding transcript
R2145:Gm1966 UTSW 7 106603008 missense possibly damaging 0.84
R4056:Gm1966 UTSW 7 106604009 missense possibly damaging 0.59
R4067:Gm1966 UTSW 7 106599565 exon noncoding transcript
R4631:Gm1966 UTSW 7 106599523 exon noncoding transcript
R4817:Gm1966 UTSW 7 106601230 exon noncoding transcript
R4900:Gm1966 UTSW 7 106598586 exon noncoding transcript
R4970:Gm1966 UTSW 7 106600657 exon noncoding transcript
R5009:Gm1966 UTSW 7 106601560 exon noncoding transcript
R5050:Gm1966 UTSW 7 106596972 exon noncoding transcript
R5086:Gm1966 UTSW 7 106598027 exon noncoding transcript
R5090:Gm1966 UTSW 7 106600902 exon noncoding transcript
R5168:Gm1966 UTSW 7 106596847 exon noncoding transcript
R5260:Gm1966 UTSW 7 106599204 exon noncoding transcript
R5331:Gm1966 UTSW 7 106598751 exon noncoding transcript
R5389:Gm1966 UTSW 7 106598235 exon noncoding transcript
R5433:Gm1966 UTSW 7 106600107 exon noncoding transcript
R5489:Gm1966 UTSW 7 106601590 exon noncoding transcript
R5504:Gm1966 UTSW 7 106602744 exon noncoding transcript
R5956:Gm1966 UTSW 7 106601470 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- ATAGATCAGATGGAAGTCAGCTCTG -3'
(R):5'- AGCCCTAAGAGCCACAGTTG -3'

Sequencing Primer
(F):5'- AAGTCAGCTCTGTGCATGC -3'
(R):5'- GCCACAGTTGAAATCACAGATGTTTC -3'
Posted On2016-10-05