Incidental Mutation 'R5500:Slitrk3'
ID430555
Institutional Source Beutler Lab
Gene Symbol Slitrk3
Ensembl Gene ENSMUSG00000048304
Gene NameSLIT and NTRK-like family, member 3
Synonyms
MMRRC Submission 043061-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.807) question?
Stock #R5500 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location73047265-73057803 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73050347 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 364 (Y364C)
Ref Sequence ENSEMBL: ENSMUSP00000141236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059407] [ENSMUST00000192477]
Predicted Effect probably damaging
Transcript: ENSMUST00000059407
AA Change: Y364C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000088561
Gene: ENSMUSG00000048304
AA Change: Y364C

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Blast:LRRNT 44 79 3e-11 BLAST
LRR 101 124 2.08e1 SMART
LRR 125 148 6.05e0 SMART
LRR 149 172 3.97e0 SMART
LRR_TYP 173 196 1.67e-2 SMART
LRR 197 220 2.69e2 SMART
LRRCT 233 283 4.56e-5 SMART
low complexity region 332 350 N/A INTRINSIC
LRRNT 373 411 4.17e0 SMART
LRR 432 455 1.62e0 SMART
LRR_TYP 456 479 2.61e-4 SMART
LRR 480 503 2.82e0 SMART
LRR_TYP 504 527 6.99e-5 SMART
LRRCT 563 613 3.22e-5 SMART
transmembrane domain 658 680 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 836 843 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 870 888 N/A INTRINSIC
Blast:LRRCT 906 943 2e-16 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000192477
AA Change: Y364C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141236
Gene: ENSMUSG00000048304
AA Change: Y364C

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Blast:LRRNT 44 79 3e-11 BLAST
LRR 101 124 2.08e1 SMART
LRR 125 148 6.05e0 SMART
LRR 149 172 3.97e0 SMART
LRR_TYP 173 196 1.67e-2 SMART
LRR 197 220 2.69e2 SMART
LRRCT 233 283 4.56e-5 SMART
low complexity region 332 350 N/A INTRINSIC
LRRNT 373 411 4.17e0 SMART
LRR 432 455 1.62e0 SMART
LRR_TYP 456 479 2.61e-4 SMART
LRR 480 503 2.82e0 SMART
LRR_TYP 504 527 6.99e-5 SMART
LRRCT 563 613 3.22e-5 SMART
transmembrane domain 658 680 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 836 843 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 870 888 N/A INTRINSIC
Blast:LRRCT 906 943 2e-16 BLAST
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Slitrk family of structurally related transmembrane proteins that are involved in controlling neurite outgrowth. The encoded protein contains two leucine-rich repeat (LRR) domains and a C-terminal domain that is partially similar to Trk neurotrophin receptor protein. Enhanced expression of this gene was found in tissue from several different types of tumors. Alternative splicing results in multiple transcript variants, all encoding the same protein. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out mice exhibit reduced inhibitory synapse density, decreased miniature inhibitory postsynaptic current frequency and increased susceptibility to spontaneous and pharmacologically-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,303,389 Q864L probably benign Het
AI182371 A G 2: 35,100,638 S16P probably damaging Het
Amy1 A T 3: 113,562,722 Y262N probably damaging Het
Cdh23 T C 10: 60,314,311 D2583G probably damaging Het
Ddx60 A G 8: 61,950,451 K303E probably benign Het
Dis3l2 T C 1: 87,021,119 probably null Het
Evi5l T A 8: 4,191,658 M329K probably damaging Het
Fam169b A G 7: 68,350,369 D221G probably damaging Het
Farsb T C 1: 78,471,124 D126G probably damaging Het
Gm4847 A G 1: 166,635,042 I293T probably damaging Het
Gm4951 G A 18: 60,246,020 R209H probably damaging Het
Ighmbp2 T C 19: 3,268,687 H463R possibly damaging Het
Kank1 A T 19: 25,424,332 D1101V possibly damaging Het
Kcnh8 G A 17: 52,725,980 M98I probably benign Het
Kdsr A G 1: 106,759,644 probably benign Het
Kif18b A T 11: 102,915,700 V107E probably damaging Het
Klhl41 A G 2: 69,683,529 E584G probably damaging Het
Kpnb1 G A 11: 97,173,111 A389V possibly damaging Het
Krtap31-2 A G 11: 99,936,347 T2A possibly damaging Het
Lama3 A T 18: 12,456,764 I784F possibly damaging Het
Lpar1 G A 4: 58,486,573 R233C probably benign Het
Neb C A 2: 52,162,067 probably null Het
Neo1 A G 9: 58,917,054 I697T possibly damaging Het
Pgm2l1 T G 7: 100,268,133 S486A probably benign Het
Prpf40a A T 2: 53,145,284 S748R probably benign Het
Recql4 A G 15: 76,705,578 probably benign Het
Rhbdl1 T C 17: 25,836,554 T20A possibly damaging Het
Ric8a T C 7: 140,858,315 Y156H probably benign Het
Rnf111 C A 9: 70,476,043 G203C possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc2a12 G A 10: 22,665,137 G297E probably damaging Het
Slc35f1 A T 10: 52,933,222 I102F probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Tdrd9 T C 12: 112,023,268 Y505H probably benign Het
Tlr1 G T 5: 64,927,098 D45E probably benign Het
Upp1 G A 11: 9,131,774 V104M probably damaging Het
Usp9y A G Y: 1,341,875 V1330A probably damaging Het
Wdyhv1 T C 15: 58,152,610 V85A possibly damaging Het
Zbed5 T A 5: 129,901,982 Y257* probably null Het
Other mutations in Slitrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Slitrk3 APN 3 73051103 missense probably damaging 1.00
IGL00857:Slitrk3 APN 3 73049841 missense probably damaging 1.00
IGL00990:Slitrk3 APN 3 73050081 missense probably damaging 1.00
IGL01010:Slitrk3 APN 3 73049273 missense probably benign 0.14
IGL01299:Slitrk3 APN 3 73049016 missense probably benign 0.43
IGL01609:Slitrk3 APN 3 73050237 missense probably damaging 1.00
IGL01881:Slitrk3 APN 3 73049306 missense probably benign 0.00
IGL01941:Slitrk3 APN 3 73051071 missense possibly damaging 0.72
IGL02183:Slitrk3 APN 3 73049979 missense probably damaging 0.97
IGL02187:Slitrk3 APN 3 73050272 missense probably damaging 1.00
IGL02478:Slitrk3 APN 3 73050713 missense probably damaging 0.96
IGL02512:Slitrk3 APN 3 73050402 missense probably benign 0.28
IGL02720:Slitrk3 APN 3 73050768 missense probably damaging 1.00
IGL03113:Slitrk3 APN 3 73050390 missense probably benign 0.00
IGL03224:Slitrk3 APN 3 73049930 missense possibly damaging 0.72
wee UTSW 3 73050785 missense probably damaging 1.00
R0233:Slitrk3 UTSW 3 73048577 missense probably benign 0.00
R0233:Slitrk3 UTSW 3 73048577 missense probably benign 0.00
R0639:Slitrk3 UTSW 3 73049649 missense probably benign 0.02
R1448:Slitrk3 UTSW 3 73050341 missense probably damaging 0.99
R1656:Slitrk3 UTSW 3 73050339 missense probably damaging 0.98
R1713:Slitrk3 UTSW 3 73049691 missense probably benign 0.00
R1992:Slitrk3 UTSW 3 73049771 missense possibly damaging 0.80
R1999:Slitrk3 UTSW 3 73049964 missense probably benign 0.13
R2359:Slitrk3 UTSW 3 73049345 missense possibly damaging 0.56
R3083:Slitrk3 UTSW 3 73048595 missense probably benign 0.00
R3153:Slitrk3 UTSW 3 73048982 nonsense probably null
R3821:Slitrk3 UTSW 3 73049216 missense possibly damaging 0.94
R4208:Slitrk3 UTSW 3 73051157 missense possibly damaging 0.67
R4323:Slitrk3 UTSW 3 73050785 missense probably damaging 1.00
R4580:Slitrk3 UTSW 3 73051206 missense probably damaging 0.96
R4730:Slitrk3 UTSW 3 73049519 missense probably benign 0.08
R4742:Slitrk3 UTSW 3 73048565 missense probably benign 0.00
R4979:Slitrk3 UTSW 3 73049796 missense possibly damaging 0.95
R5018:Slitrk3 UTSW 3 73050512 missense probably benign 0.31
R5023:Slitrk3 UTSW 3 73050648 missense probably benign 0.24
R5057:Slitrk3 UTSW 3 73050648 missense probably benign 0.24
R5156:Slitrk3 UTSW 3 73049259 missense probably benign
R5582:Slitrk3 UTSW 3 73050404 missense probably benign 0.09
R5797:Slitrk3 UTSW 3 73048629 missense probably damaging 0.99
R5963:Slitrk3 UTSW 3 73050713 missense probably benign 0.30
R5985:Slitrk3 UTSW 3 73050900 missense probably damaging 1.00
R6123:Slitrk3 UTSW 3 73049762 missense probably damaging 1.00
R6393:Slitrk3 UTSW 3 73049914 missense possibly damaging 0.79
R6529:Slitrk3 UTSW 3 73051218 missense probably benign 0.02
R6584:Slitrk3 UTSW 3 73049225 missense probably damaging 0.99
R6645:Slitrk3 UTSW 3 73049861 missense probably benign 0.13
R7001:Slitrk3 UTSW 3 73050609 nonsense probably null
R7282:Slitrk3 UTSW 3 73050465 missense possibly damaging 0.70
R7534:Slitrk3 UTSW 3 73050107 missense probably damaging 0.98
X0022:Slitrk3 UTSW 3 73050266 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCTAGGTGCAAGAGATCC -3'
(R):5'- TGGCCAACTAAACCTTCCTC -3'

Sequencing Primer
(F):5'- CCAAAAATCAGAGCGGTATATCTTC -3'
(R):5'- GGCCAACTAAACCTTCCTCTATGTTG -3'
Posted On2016-10-05