Incidental Mutation 'R5500:Neo1'
ID430567
Institutional Source Beutler Lab
Gene Symbol Neo1
Ensembl Gene ENSMUSG00000032340
Gene Nameneogenin
Synonyms2610028H22Rik, D930014N22Rik, Igdcc2
MMRRC Submission 043061-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5500 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location58874687-59036441 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58917054 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 697 (I697T)
Ref Sequence ENSEMBL: ENSMUSP00000150600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068664] [ENSMUST00000214547]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068664
AA Change: I697T

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000063656
Gene: ENSMUSG00000032340
AA Change: I697T

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
IGc2 76 147 9.49e-5 SMART
IGc2 175 239 4.43e-5 SMART
IGc2 272 338 6.15e-13 SMART
IGc2 364 428 7.76e-10 SMART
low complexity region 446 458 N/A INTRINSIC
FN3 470 553 8.23e-12 SMART
FN3 570 649 1.78e-16 SMART
FN3 665 749 1.54e-11 SMART
FN3 770 849 5.27e-10 SMART
FN3 885 970 7.63e-7 SMART
FN3 986 1072 2.78e-9 SMART
transmembrane domain 1136 1158 N/A INTRINSIC
Pfam:Neogenin_C 1189 1492 1.9e-122 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214547
AA Change: I697T

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215026
Predicted Effect probably benign
Transcript: ENSMUST00000216964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217545
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface protein that is a member of the immunoglobulin superfamily. The encoded protein consists of four N-terminal immunoglobulin-like domains, six fibronectin type III domains, a transmembrane domain and a C-terminal internal domain that shares homology with the tumor suppressor candidate gene DCC. This protein may be involved in cell growth and differentiation and in cell-cell adhesion. Defects in this gene are associated with cell proliferation in certain cancers. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display perinatal lethality and abnormal trigeminal nerve development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,303,389 Q864L probably benign Het
AI182371 A G 2: 35,100,638 S16P probably damaging Het
Amy1 A T 3: 113,562,722 Y262N probably damaging Het
Cdh23 T C 10: 60,314,311 D2583G probably damaging Het
Ddx60 A G 8: 61,950,451 K303E probably benign Het
Dis3l2 T C 1: 87,021,119 probably null Het
Evi5l T A 8: 4,191,658 M329K probably damaging Het
Fam169b A G 7: 68,350,369 D221G probably damaging Het
Farsb T C 1: 78,471,124 D126G probably damaging Het
Gm4847 A G 1: 166,635,042 I293T probably damaging Het
Gm4951 G A 18: 60,246,020 R209H probably damaging Het
Ighmbp2 T C 19: 3,268,687 H463R possibly damaging Het
Kank1 A T 19: 25,424,332 D1101V possibly damaging Het
Kcnh8 G A 17: 52,725,980 M98I probably benign Het
Kdsr A G 1: 106,759,644 probably benign Het
Kif18b A T 11: 102,915,700 V107E probably damaging Het
Klhl41 A G 2: 69,683,529 E584G probably damaging Het
Kpnb1 G A 11: 97,173,111 A389V possibly damaging Het
Krtap31-2 A G 11: 99,936,347 T2A possibly damaging Het
Lama3 A T 18: 12,456,764 I784F possibly damaging Het
Lpar1 G A 4: 58,486,573 R233C probably benign Het
Neb C A 2: 52,162,067 probably null Het
Pgm2l1 T G 7: 100,268,133 S486A probably benign Het
Prpf40a A T 2: 53,145,284 S748R probably benign Het
Recql4 A G 15: 76,705,578 probably benign Het
Rhbdl1 T C 17: 25,836,554 T20A possibly damaging Het
Ric8a T C 7: 140,858,315 Y156H probably benign Het
Rnf111 C A 9: 70,476,043 G203C possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc2a12 G A 10: 22,665,137 G297E probably damaging Het
Slc35f1 A T 10: 52,933,222 I102F probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slitrk3 T C 3: 73,050,347 Y364C probably damaging Het
Tdrd9 T C 12: 112,023,268 Y505H probably benign Het
Tlr1 G T 5: 64,927,098 D45E probably benign Het
Upp1 G A 11: 9,131,774 V104M probably damaging Het
Usp9y A G Y: 1,341,875 V1330A probably damaging Het
Wdyhv1 T C 15: 58,152,610 V85A possibly damaging Het
Zbed5 T A 5: 129,901,982 Y257* probably null Het
Other mutations in Neo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Neo1 APN 9 58921919 splice site probably benign
IGL00885:Neo1 APN 9 58888463 missense probably damaging 1.00
IGL01103:Neo1 APN 9 58880799 missense possibly damaging 0.60
IGL01322:Neo1 APN 9 58907085 missense possibly damaging 0.68
IGL02216:Neo1 APN 9 58917053 missense probably damaging 0.96
IGL02327:Neo1 APN 9 58903088 missense probably benign 0.08
IGL02392:Neo1 APN 9 58925811 missense possibly damaging 0.49
IGL02458:Neo1 APN 9 58893867 splice site probably benign
IGL03057:Neo1 APN 9 58878059 missense probably damaging 1.00
IGL03091:Neo1 APN 9 58978668 missense probably damaging 0.98
IGL03193:Neo1 APN 9 58908484 missense probably damaging 1.00
R0097:Neo1 UTSW 9 58882021 intron probably benign
R0419:Neo1 UTSW 9 58990180 splice site probably benign
R0571:Neo1 UTSW 9 58985786 missense probably benign
R0646:Neo1 UTSW 9 58931034 missense probably damaging 1.00
R0736:Neo1 UTSW 9 58917081 missense possibly damaging 0.78
R0739:Neo1 UTSW 9 58921877 missense probably benign 0.22
R1636:Neo1 UTSW 9 58913277 missense probably damaging 1.00
R1694:Neo1 UTSW 9 58880603 missense probably damaging 1.00
R1827:Neo1 UTSW 9 58917031 nonsense probably null
R1927:Neo1 UTSW 9 58990385 missense probably benign 0.12
R2354:Neo1 UTSW 9 58985634 missense probably benign
R2365:Neo1 UTSW 9 58956003 missense probably benign
R3156:Neo1 UTSW 9 58888979 splice site probably null
R3552:Neo1 UTSW 9 58893878 missense probably damaging 1.00
R3829:Neo1 UTSW 9 58913169 missense possibly damaging 0.58
R4477:Neo1 UTSW 9 58877299 missense probably damaging 0.99
R4613:Neo1 UTSW 9 58889041 missense possibly damaging 0.94
R5023:Neo1 UTSW 9 58990271 missense probably damaging 1.00
R5046:Neo1 UTSW 9 58893911 missense possibly damaging 0.77
R5057:Neo1 UTSW 9 58990271 missense probably damaging 1.00
R5323:Neo1 UTSW 9 58906648 critical splice donor site probably null
R5394:Neo1 UTSW 9 58990234 missense probably benign 0.10
R5470:Neo1 UTSW 9 58931067 missense probably damaging 1.00
R5473:Neo1 UTSW 9 58880843 missense possibly damaging 0.88
R5503:Neo1 UTSW 9 58985650 missense possibly damaging 0.67
R6122:Neo1 UTSW 9 58917008 missense probably benign
R6191:Neo1 UTSW 9 58889029 missense probably damaging 1.00
R6431:Neo1 UTSW 9 58907071 missense probably benign 0.27
R6560:Neo1 UTSW 9 58880601 missense possibly damaging 0.95
R6658:Neo1 UTSW 9 58921849 missense probably benign 0.14
R6772:Neo1 UTSW 9 58902976 missense probably damaging 1.00
R6912:Neo1 UTSW 9 58917052 missense probably benign 0.00
R7061:Neo1 UTSW 9 58990441 missense possibly damaging 0.95
R7145:Neo1 UTSW 9 58889179 missense probably damaging 1.00
R7156:Neo1 UTSW 9 58902923 missense probably damaging 1.00
X0063:Neo1 UTSW 9 58990298 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGAGGAATCCACCAGAGTATTTTC -3'
(R):5'- AGGCTCCAAGTACCAAGGGTTC -3'

Sequencing Primer
(F):5'- CCACCAGAGTATTTTCCATTAATTTG -3'
(R):5'- GCTCCAAGTACCAAGGGTTCTATATG -3'
Posted On2016-10-05