Incidental Mutation 'R5500:Slc2a12'
ID430569
Institutional Source Beutler Lab
Gene Symbol Slc2a12
Ensembl Gene ENSMUSG00000037490
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 12
SynonymsGlut12, GLUT-12
MMRRC Submission 043061-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5500 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location22645011-22704285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 22665137 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 297 (G297E)
Ref Sequence ENSEMBL: ENSMUSP00000043962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042261]
Predicted Effect probably damaging
Transcript: ENSMUST00000042261
AA Change: G297E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043962
Gene: ENSMUSG00000037490
AA Change: G297E

DomainStartEndE-ValueType
Pfam:MFS_1 42 390 5.3e-27 PFAM
Pfam:Sugar_tr 47 381 9.1e-76 PFAM
Pfam:Sugar_tr 451 569 4e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159174
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC2A12 belongs to a family of transporters that catalyze the uptake of sugars through facilitated diffusion (Rogers et al., 2002). This family of transporters show conservation of 12 transmembrane helices as well as functionally significant amino acid residues (Joost and Thorens, 2001 [PubMed 11780753]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,303,389 Q864L probably benign Het
AI182371 A G 2: 35,100,638 S16P probably damaging Het
Amy1 A T 3: 113,562,722 Y262N probably damaging Het
Cdh23 T C 10: 60,314,311 D2583G probably damaging Het
Ddx60 A G 8: 61,950,451 K303E probably benign Het
Dis3l2 T C 1: 87,021,119 probably null Het
Evi5l T A 8: 4,191,658 M329K probably damaging Het
Fam169b A G 7: 68,350,369 D221G probably damaging Het
Farsb T C 1: 78,471,124 D126G probably damaging Het
Gm4847 A G 1: 166,635,042 I293T probably damaging Het
Gm4951 G A 18: 60,246,020 R209H probably damaging Het
Ighmbp2 T C 19: 3,268,687 H463R possibly damaging Het
Kank1 A T 19: 25,424,332 D1101V possibly damaging Het
Kcnh8 G A 17: 52,725,980 M98I probably benign Het
Kdsr A G 1: 106,759,644 probably benign Het
Kif18b A T 11: 102,915,700 V107E probably damaging Het
Klhl41 A G 2: 69,683,529 E584G probably damaging Het
Kpnb1 G A 11: 97,173,111 A389V possibly damaging Het
Krtap31-2 A G 11: 99,936,347 T2A possibly damaging Het
Lama3 A T 18: 12,456,764 I784F possibly damaging Het
Lpar1 G A 4: 58,486,573 R233C probably benign Het
Neb C A 2: 52,162,067 probably null Het
Neo1 A G 9: 58,917,054 I697T possibly damaging Het
Pgm2l1 T G 7: 100,268,133 S486A probably benign Het
Prpf40a A T 2: 53,145,284 S748R probably benign Het
Recql4 A G 15: 76,705,578 probably benign Het
Rhbdl1 T C 17: 25,836,554 T20A possibly damaging Het
Ric8a T C 7: 140,858,315 Y156H probably benign Het
Rnf111 C A 9: 70,476,043 G203C possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc35f1 A T 10: 52,933,222 I102F probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slitrk3 T C 3: 73,050,347 Y364C probably damaging Het
Tdrd9 T C 12: 112,023,268 Y505H probably benign Het
Tlr1 G T 5: 64,927,098 D45E probably benign Het
Upp1 G A 11: 9,131,774 V104M probably damaging Het
Usp9y A G Y: 1,341,875 V1330A probably damaging Het
Wdyhv1 T C 15: 58,152,610 V85A possibly damaging Het
Zbed5 T A 5: 129,901,982 Y257* probably null Het
Other mutations in Slc2a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Slc2a12 APN 10 22664684 missense probably damaging 0.97
IGL02472:Slc2a12 APN 10 22665155 missense probably damaging 1.00
IGL03387:Slc2a12 APN 10 22665235 missense probably damaging 1.00
IGL03412:Slc2a12 APN 10 22664969 missense probably damaging 1.00
R0537:Slc2a12 UTSW 10 22665068 missense probably damaging 1.00
R0539:Slc2a12 UTSW 10 22692230 missense probably benign 0.04
R0744:Slc2a12 UTSW 10 22702016 unclassified probably benign
R0833:Slc2a12 UTSW 10 22702016 unclassified probably benign
R1056:Slc2a12 UTSW 10 22665451 missense probably benign 0.05
R1926:Slc2a12 UTSW 10 22665242 missense probably damaging 1.00
R2188:Slc2a12 UTSW 10 22664837 missense probably benign 0.01
R2471:Slc2a12 UTSW 10 22664807 missense probably damaging 1.00
R4212:Slc2a12 UTSW 10 22702094 missense probably benign 0.02
R4213:Slc2a12 UTSW 10 22702094 missense probably benign 0.02
R4543:Slc2a12 UTSW 10 22664786 missense probably damaging 1.00
R5203:Slc2a12 UTSW 10 22645314 critical splice donor site probably null
R5203:Slc2a12 UTSW 10 22692218 missense probably benign
R5223:Slc2a12 UTSW 10 22702032 missense probably damaging 0.99
R6119:Slc2a12 UTSW 10 22665347 missense probably damaging 1.00
R6149:Slc2a12 UTSW 10 22664502 missense probably benign 0.05
R6281:Slc2a12 UTSW 10 22665320 missense probably damaging 1.00
R6330:Slc2a12 UTSW 10 22664995 missense probably benign 0.00
R6385:Slc2a12 UTSW 10 22694030 missense possibly damaging 0.69
R6623:Slc2a12 UTSW 10 22664900 missense probably damaging 1.00
R6895:Slc2a12 UTSW 10 22692185 missense probably damaging 1.00
R7080:Slc2a12 UTSW 10 22665317 missense probably benign 0.34
R7152:Slc2a12 UTSW 10 22665554 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTCGTTTCCTGGTGATGAAG -3'
(R):5'- TCACGGAGGAGCCAATACAG -3'

Sequencing Primer
(F):5'- TCGGCAGGCAAAGTCCTCAG -3'
(R):5'- CCAATACAGAGGAAGGTTTTGCTGC -3'
Posted On2016-10-05