Incidental Mutation 'R5501:Dync1li2'
ID430615
Institutional Source Beutler Lab
Gene Symbol Dync1li2
Ensembl Gene ENSMUSG00000035770
Gene Namedynein, cytoplasmic 1 light intermediate chain 2
SynonymsLIC2, Dnclic2, Dncli2
MMRRC Submission 043062-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R5501 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location104417680-104443047 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 104440472 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000041769] [ENSMUST00000212148] [ENSMUST00000212654]
Predicted Effect probably null
Transcript: ENSMUST00000041769
SMART Domains Protein: ENSMUSP00000045480
Gene: ENSMUSG00000035770

DomainStartEndE-ValueType
Pfam:DLIC 30 491 5.8e-264 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212040
Predicted Effect probably benign
Transcript: ENSMUST00000212148
Predicted Effect probably null
Transcript: ENSMUST00000212230
Predicted Effect probably benign
Transcript: ENSMUST00000212654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212678
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytoplasmic dynein is a microtubule-associated motor protein (Hughes et al., 1995 [PubMed 7738094]). See DYNC1H1 (MIM 600112) for general information about dyneins.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A C 8: 43,569,904 L183* probably null Het
Alox12e G T 11: 70,316,229 Q584K probably benign Het
Atp1a4 A G 1: 172,246,832 S285P probably damaging Het
Cdt1 C T 8: 122,570,500 R311W probably damaging Het
Col25a1 A G 3: 130,595,663 T632A probably benign Het
Coro6 T C 11: 77,467,796 F227S probably damaging Het
Diras2 C T 13: 52,507,750 V174M probably benign Het
Dopey1 A G 9: 86,507,730 D569G probably benign Het
Dysf T C 6: 84,087,818 V508A probably damaging Het
Edem1 T C 6: 108,843,100 probably null Het
Eef2k A G 7: 120,889,248 D452G probably benign Het
Espl1 A G 15: 102,317,130 R1539G possibly damaging Het
Fat4 A G 3: 38,887,215 S86G probably benign Het
Hpgd A T 8: 56,298,356 D73V probably benign Het
Ltb4r1 A G 14: 55,768,082 N281D probably damaging Het
Map7 T C 10: 20,276,202 S638P unknown Het
Mical1 G A 10: 41,486,079 A934T probably benign Het
Micu3 C A 8: 40,354,300 probably null Het
Mmp24 T A 2: 155,798,136 Y129N probably damaging Het
Mras A T 9: 99,411,546 Y14N probably damaging Het
Msmo1 A T 8: 64,722,489 I169N probably damaging Het
Mtrr G T 13: 68,579,647 T60K probably damaging Het
Olfr1218 A T 2: 89,054,886 L180* probably null Het
Olfr478 G T 7: 108,032,153 Y63* probably null Het
Olfr849 T A 9: 19,440,994 I27N possibly damaging Het
Pam A T 1: 97,840,365 C8* probably null Het
Phrf1 T G 7: 141,259,921 S1169A possibly damaging Het
Pkd1l2 T C 8: 117,065,830 T408A probably damaging Het
Plch1 G T 3: 63,707,741 Q778K probably damaging Het
Ppp1r3a A G 6: 14,719,418 V499A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ryr3 C A 2: 112,662,504 S3736I possibly damaging Het
Serpinb13 T C 1: 106,982,185 F11L possibly damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Smcp A G 3: 92,584,424 C39R unknown Het
Sox9 T A 11: 112,783,859 L161Q probably damaging Het
Tanc2 T C 11: 105,914,985 probably null Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Tmem131l G T 3: 83,926,128 N809K probably damaging Het
Tyk2 T C 9: 21,121,612 Y285C probably damaging Het
Usp15 T A 10: 123,175,899 N98Y probably damaging Het
Other mutations in Dync1li2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Dync1li2 APN 8 104442498 missense possibly damaging 0.95
IGL01143:Dync1li2 APN 8 104429453 missense probably damaging 0.96
E0354:Dync1li2 UTSW 8 104425467 missense probably damaging 0.99
R0102:Dync1li2 UTSW 8 104428125 missense probably benign 0.00
R0102:Dync1li2 UTSW 8 104428125 missense probably benign 0.00
R0555:Dync1li2 UTSW 8 104420665 missense probably benign
R0784:Dync1li2 UTSW 8 104442498 missense probably damaging 0.99
R1532:Dync1li2 UTSW 8 104426035 missense probably damaging 1.00
R1632:Dync1li2 UTSW 8 104437491 missense probably damaging 0.99
R2877:Dync1li2 UTSW 8 104429415 missense probably damaging 1.00
R2878:Dync1li2 UTSW 8 104429415 missense probably damaging 1.00
R4272:Dync1li2 UTSW 8 104423143 missense probably damaging 0.96
R4380:Dync1li2 UTSW 8 104428166 missense probably damaging 1.00
R5050:Dync1li2 UTSW 8 104437441 missense probably damaging 1.00
R5218:Dync1li2 UTSW 8 104442547 nonsense probably null
R5628:Dync1li2 UTSW 8 104420592 missense possibly damaging 0.95
R6542:Dync1li2 UTSW 8 104442764 missense probably benign 0.09
R6727:Dync1li2 UTSW 8 104440535 missense probably damaging 0.98
R7384:Dync1li2 UTSW 8 104442543 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCAGGCACCAATAACTATTCTACAG -3'
(R):5'- ATGACTGGCTGTCTTTGCGC -3'

Sequencing Primer
(F):5'- CAGAGTAATATCTCTTGAGCGGTC -3'
(R):5'- GCAGAGCGATACATGGTATACTTTTG -3'
Posted On2016-10-05