Incidental Mutation 'R5501:Rnd2'
ID430627
Institutional Source Beutler Lab
Gene Symbol Rnd2
Ensembl Gene ENSMUSG00000001313
Gene NameRho family GTPase 2
SynonymsArhn, Rohn
MMRRC Submission 043062-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5501 (G1)
Quality Score222
Status Not validated
Chromosome11
Chromosomal Location101464999-101471853 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101468999 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 57 (L57F)
Ref Sequence ENSEMBL: ENSMUSP00000001347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001347] [ENSMUST00000040430]
Predicted Effect probably damaging
Transcript: ENSMUST00000001347
AA Change: L57F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001347
Gene: ENSMUSG00000001313
AA Change: L57F

DomainStartEndE-ValueType
RHO 10 184 5.22e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040430
SMART Domains Protein: ENSMUSP00000048350
Gene: ENSMUSG00000034993

DomainStartEndE-ValueType
low complexity region 3 31 N/A INTRINSIC
low complexity region 41 60 N/A INTRINSIC
Pfam:ADH_N 89 157 8.8e-11 PFAM
Pfam:ADH_zinc_N 213 355 2.1e-21 PFAM
Pfam:ADH_zinc_N_2 245 398 6.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153185
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho GTPase family, whose members play a key role in the regulation of actin cytoskeleton organization in response to extracellular growth factors. This particular family member has been implicated in the regulation of neuronal morphology and endosomal trafficking. The gene localizes to chromosome 17 and is the centromeric neighbor of the breast-ovarian cancer susceptibility gene BRCA1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A C 8: 43,569,904 L183* probably null Het
Alox12e G T 11: 70,316,229 Q584K probably benign Het
Atp1a4 A G 1: 172,246,832 S285P probably damaging Het
Cdt1 C T 8: 122,570,500 R311W probably damaging Het
Col25a1 A G 3: 130,595,663 T632A probably benign Het
Coro6 T C 11: 77,467,796 F227S probably damaging Het
Diras2 C T 13: 52,507,750 V174M probably benign Het
Dopey1 A G 9: 86,507,730 D569G probably benign Het
Dync1li2 A G 8: 104,440,472 probably null Het
Dysf T C 6: 84,087,818 V508A probably damaging Het
Edem1 T C 6: 108,843,100 probably null Het
Eef2k A G 7: 120,889,248 D452G probably benign Het
Espl1 A G 15: 102,317,130 R1539G possibly damaging Het
Fat4 A G 3: 38,887,215 S86G probably benign Het
Hpgd A T 8: 56,298,356 D73V probably benign Het
Ltb4r1 A G 14: 55,768,082 N281D probably damaging Het
Map7 T C 10: 20,276,202 S638P unknown Het
Mical1 G A 10: 41,486,079 A934T probably benign Het
Micu3 C A 8: 40,354,300 probably null Het
Mmp24 T A 2: 155,798,136 Y129N probably damaging Het
Mras A T 9: 99,411,546 Y14N probably damaging Het
Msmo1 A T 8: 64,722,489 I169N probably damaging Het
Mtrr G T 13: 68,579,647 T60K probably damaging Het
Olfr1218 A T 2: 89,054,886 L180* probably null Het
Olfr478 G T 7: 108,032,153 Y63* probably null Het
Olfr849 T A 9: 19,440,994 I27N possibly damaging Het
Pam A T 1: 97,840,365 C8* probably null Het
Phrf1 T G 7: 141,259,921 S1169A possibly damaging Het
Pkd1l2 T C 8: 117,065,830 T408A probably damaging Het
Plch1 G T 3: 63,707,741 Q778K probably damaging Het
Ppp1r3a A G 6: 14,719,418 V499A probably benign Het
Ryr3 C A 2: 112,662,504 S3736I possibly damaging Het
Serpinb13 T C 1: 106,982,185 F11L possibly damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Smcp A G 3: 92,584,424 C39R unknown Het
Sox9 T A 11: 112,783,859 L161Q probably damaging Het
Tanc2 T C 11: 105,914,985 probably null Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Tmem131l G T 3: 83,926,128 N809K probably damaging Het
Tyk2 T C 9: 21,121,612 Y285C probably damaging Het
Usp15 T A 10: 123,175,899 N98Y probably damaging Het
Other mutations in Rnd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Rnd2 APN 11 101471191 missense possibly damaging 0.81
IGL01964:Rnd2 APN 11 101470806 unclassified probably null
Atkins UTSW 11 101468999 missense probably damaging 1.00
R1581:Rnd2 UTSW 11 101471196 missense probably benign
R4606:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R4797:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R4824:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R4825:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R4931:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5005:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5078:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5079:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5402:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5405:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5497:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5498:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5534:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5619:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5666:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5669:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5670:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5671:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5786:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5788:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5844:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5845:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5857:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5989:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5991:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5992:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6018:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6019:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6020:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6122:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6144:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6148:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6208:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6209:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6226:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6230:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6332:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6333:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6335:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6491:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6541:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6605:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6606:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6607:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6677:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6678:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6726:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6796:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6797:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCTCAGACCAACTTCTG -3'
(R):5'- CCTACGTGGTTTCTGTCAGG -3'

Sequencing Primer
(F):5'- ACCAACTTCTGTCTAGGGACTGAG -3'
(R):5'- GGTTTCTGTCAGGCCTAAGAAACTC -3'
Posted On2016-10-05