Incidental Mutation 'R5501:Espl1'
ID430634
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Nameextra spindle pole bodies 1, separase
SynonymsSSE, ESP1, PRCE, Cerp, PRCE, separase
MMRRC Submission 043062-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5501 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location102296266-102324357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102317130 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 1539 (R1539G)
Ref Sequence ENSEMBL: ENSMUSP00000155304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064924
AA Change: R1539G

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: R1539G

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000229050
AA Change: R1539G

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230617
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A C 8: 43,569,904 L183* probably null Het
Alox12e G T 11: 70,316,229 Q584K probably benign Het
Atp1a4 A G 1: 172,246,832 S285P probably damaging Het
Cdt1 C T 8: 122,570,500 R311W probably damaging Het
Col25a1 A G 3: 130,595,663 T632A probably benign Het
Coro6 T C 11: 77,467,796 F227S probably damaging Het
Diras2 C T 13: 52,507,750 V174M probably benign Het
Dopey1 A G 9: 86,507,730 D569G probably benign Het
Dync1li2 A G 8: 104,440,472 probably null Het
Dysf T C 6: 84,087,818 V508A probably damaging Het
Edem1 T C 6: 108,843,100 probably null Het
Eef2k A G 7: 120,889,248 D452G probably benign Het
Fat4 A G 3: 38,887,215 S86G probably benign Het
Hpgd A T 8: 56,298,356 D73V probably benign Het
Ltb4r1 A G 14: 55,768,082 N281D probably damaging Het
Map7 T C 10: 20,276,202 S638P unknown Het
Mical1 G A 10: 41,486,079 A934T probably benign Het
Micu3 C A 8: 40,354,300 probably null Het
Mmp24 T A 2: 155,798,136 Y129N probably damaging Het
Mras A T 9: 99,411,546 Y14N probably damaging Het
Msmo1 A T 8: 64,722,489 I169N probably damaging Het
Mtrr G T 13: 68,579,647 T60K probably damaging Het
Olfr1218 A T 2: 89,054,886 L180* probably null Het
Olfr478 G T 7: 108,032,153 Y63* probably null Het
Olfr849 T A 9: 19,440,994 I27N possibly damaging Het
Pam A T 1: 97,840,365 C8* probably null Het
Phrf1 T G 7: 141,259,921 S1169A possibly damaging Het
Pkd1l2 T C 8: 117,065,830 T408A probably damaging Het
Plch1 G T 3: 63,707,741 Q778K probably damaging Het
Ppp1r3a A G 6: 14,719,418 V499A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ryr3 C A 2: 112,662,504 S3736I possibly damaging Het
Serpinb13 T C 1: 106,982,185 F11L possibly damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Smcp A G 3: 92,584,424 C39R unknown Het
Sox9 T A 11: 112,783,859 L161Q probably damaging Het
Tanc2 T C 11: 105,914,985 probably null Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Tmem131l G T 3: 83,926,128 N809K probably damaging Het
Tyk2 T C 9: 21,121,612 Y285C probably damaging Het
Usp15 T A 10: 123,175,899 N98Y probably damaging Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102299813 missense probably damaging 1.00
IGL00839:Espl1 APN 15 102320547 unclassified probably benign
IGL00919:Espl1 APN 15 102298629 missense probably benign 0.03
IGL01125:Espl1 APN 15 102322938 missense probably damaging 1.00
IGL01366:Espl1 APN 15 102319836 missense probably benign 0.00
IGL01488:Espl1 APN 15 102298739 missense probably benign
IGL01554:Espl1 APN 15 102313225 missense probably damaging 1.00
IGL01810:Espl1 APN 15 102298205 missense probably benign
IGL01959:Espl1 APN 15 102305662 splice site probably benign
IGL02267:Espl1 APN 15 102315664 missense probably benign 0.01
IGL02452:Espl1 APN 15 102299839 missense probably damaging 1.00
IGL02469:Espl1 APN 15 102314025 missense probably damaging 1.00
IGL02500:Espl1 APN 15 102315800 missense probably benign
IGL02630:Espl1 APN 15 102296818 missense probably benign 0.11
IGL02687:Espl1 APN 15 102313178 splice site probably benign
IGL02868:Espl1 APN 15 102313990 nonsense probably null
IGL02926:Espl1 APN 15 102299855 missense probably damaging 0.99
R0019:Espl1 UTSW 15 102306319 missense probably null 0.01
R0129:Espl1 UTSW 15 102316648 missense probably benign 0.00
R0184:Espl1 UTSW 15 102299216 missense probably benign 0.01
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0267:Espl1 UTSW 15 102313017 missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102303986 nonsense probably null
R0587:Espl1 UTSW 15 102303947 splice site probably benign
R0726:Espl1 UTSW 15 102322598 missense probably benign
R1186:Espl1 UTSW 15 102304039 missense probably benign 0.05
R1282:Espl1 UTSW 15 102315391 missense probably benign 0.00
R1428:Espl1 UTSW 15 102305685 missense probably benign 0.06
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1473:Espl1 UTSW 15 102320443 missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102298367 missense probably damaging 0.98
R1639:Espl1 UTSW 15 102320714 missense probably damaging 1.00
R1725:Espl1 UTSW 15 102313221 missense probably benign 0.08
R1748:Espl1 UTSW 15 102298529 missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102299013 missense probably benign
R1938:Espl1 UTSW 15 102305042 missense probably benign 0.00
R1954:Espl1 UTSW 15 102298388 missense probably damaging 1.00
R2009:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2014:Espl1 UTSW 15 102322714 nonsense probably null
R2067:Espl1 UTSW 15 102299090 missense probably damaging 0.96
R2084:Espl1 UTSW 15 102296851 critical splice donor site probably null
R2164:Espl1 UTSW 15 102319588 missense probably damaging 1.00
R2204:Espl1 UTSW 15 102305905 missense probably damaging 1.00
R2220:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2237:Espl1 UTSW 15 102315569 missense probably damaging 0.98
R2314:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3107:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3108:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3114:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3616:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3733:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3958:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3959:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3960:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4062:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4063:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4064:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4165:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4166:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4349:Espl1 UTSW 15 102319604 missense probably benign 0.26
R4373:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4376:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4377:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4516:Espl1 UTSW 15 102323236 missense probably benign 0.00
R4595:Espl1 UTSW 15 102298724 missense probably benign 0.01
R4884:Espl1 UTSW 15 102324070 missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102322323 critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102315241 missense probably damaging 0.98
R4931:Espl1 UTSW 15 102305730 missense probably benign 0.02
R4936:Espl1 UTSW 15 102304937 missense probably damaging 1.00
R5000:Espl1 UTSW 15 102298551 missense probably damaging 1.00
R5220:Espl1 UTSW 15 102298577 missense probably benign 0.03
R5329:Espl1 UTSW 15 102312518 missense probably damaging 0.97
R5788:Espl1 UTSW 15 102324030 missense probably damaging 1.00
R5848:Espl1 UTSW 15 102322576 missense probably benign 0.03
R5906:Espl1 UTSW 15 102296851 critical splice donor site probably null
R5978:Espl1 UTSW 15 102315774 missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102299888 missense probably damaging 0.99
R6313:Espl1 UTSW 15 102315812 missense probably benign 0.00
R6414:Espl1 UTSW 15 102315560 missense probably damaging 0.96
R6484:Espl1 UTSW 15 102323500 missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102299225 missense probably benign
R6928:Espl1 UTSW 15 102298907 missense probably benign 0.28
R6995:Espl1 UTSW 15 102304100 missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102316893 critical splice donor site probably null
R7062:Espl1 UTSW 15 102298896 missense probably benign 0.00
R7135:Espl1 UTSW 15 102319524 nonsense probably null
X0062:Espl1 UTSW 15 102298397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGTAGGACTTCAAGGGC -3'
(R):5'- GTCCTTTAAAAGTGTGCCTCC -3'

Sequencing Primer
(F):5'- GCAGAAGGCACGTGTTCTG -3'
(R):5'- TAAAAGTGTGCCTCCTGAAAAAG -3'
Posted On2016-10-05