Incidental Mutation 'R5502:Olfr351'
ID430641
Institutional Source Beutler Lab
Gene Symbol Olfr351
Ensembl Gene ENSMUSG00000075383
Gene Nameolfactory receptor 351
SynonymsMOR127-2, GA_x6K02T2NLDC-33554926-33553994
MMRRC Submission 043063-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R5502 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location36857539-36862660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36860270 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 26 (Y26C)
Ref Sequence ENSEMBL: ENSMUSP00000150346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100150] [ENSMUST00000213676] [ENSMUST00000215137]
Predicted Effect probably damaging
Transcript: ENSMUST00000100150
AA Change: Y26C

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097727
Gene: ENSMUSG00000075383
AA Change: Y26C

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.7e-56 PFAM
Pfam:7tm_1 39 288 5.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213676
AA Change: Y26C

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000215137
AA Change: Y26C

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.0244 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.0%
  • 20x: 90.2%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abcc8 A G 7: 46,108,838 I1268T probably benign Het
Accsl C T 2: 93,856,944 probably null Het
Ank3 A T 10: 69,920,461 I842F probably benign Het
Bbs9 T A 9: 22,504,074 L98Q probably damaging Het
BC017158 C T 7: 128,285,136 V225M probably damaging Het
BC024978 A G 7: 27,197,117 D35G possibly damaging Het
Bin2 A G 15: 100,645,405 V299A probably benign Het
Cabp4 G A 19: 4,131,229 probably benign Het
Ces2f A T 8: 104,952,523 H324L possibly damaging Het
Chd4 G A 6: 125,105,276 R576Q possibly damaging Het
Cndp1 A G 18: 84,632,013 V185A possibly damaging Het
Cntn3 A C 6: 102,265,334 V450G possibly damaging Het
Col5a2 C A 1: 45,380,126 G1265W probably damaging Het
Corin G A 5: 72,316,106 Q754* probably null Het
Cyp4a10 A G 4: 115,525,505 N291S probably benign Het
Dap3 T C 3: 88,925,326 Y353C probably damaging Het
Disp1 A G 1: 183,087,886 V990A probably damaging Het
Dock9 A T 14: 121,610,182 probably null Het
Dopey2 T A 16: 93,793,226 V179E probably benign Het
Eps15l1 A T 8: 72,378,992 probably null Het
Fyb2 A T 4: 104,945,324 Q141L probably damaging Het
Gemin4 A T 11: 76,213,401 L178* probably null Het
Gm15446 A T 5: 109,940,498 K25* probably null Het
Gm17067 A T 7: 42,708,419 C220S probably damaging Het
Gm4868 A G 5: 125,847,978 noncoding transcript Het
Golga4 GT GTT 9: 118,559,057 probably null Het
Gria2 T C 3: 80,706,945 N596S probably damaging Het
Hoxb4 A G 11: 96,320,231 D219G probably damaging Het
Htr1b T A 9: 81,631,801 Q251L possibly damaging Het
Ibtk A C 9: 85,720,863 S696R probably benign Het
Ide C A 19: 37,330,456 K52N unknown Het
Incenp C A 19: 9,893,364 L300F unknown Het
Ino80 T C 2: 119,402,396 Y1147C probably damaging Het
Mme T A 3: 63,300,281 Y49* probably null Het
Mmp15 A T 8: 95,368,184 T229S possibly damaging Het
Mtmr4 A T 11: 87,614,078 N1133I probably damaging Het
Mycbp2 C T 14: 103,173,814 G284R probably damaging Het
Myo3a T C 2: 22,558,369 I52T probably damaging Het
Nat8f5 G T 6: 85,817,653 F108L probably damaging Het
Nbeal1 T A 1: 60,310,999 H2402Q probably damaging Het
Nexn T A 3: 152,238,304 E331D probably damaging Het
Nktr C T 9: 121,748,606 probably benign Het
Oaz3 T C 3: 94,435,085 D88G probably damaging Het
Olfr723 A G 14: 49,929,536 Y3H probably benign Het
Pcdhb9 A T 18: 37,401,603 T217S possibly damaging Het
Pcdhga2 A T 18: 37,670,552 D483V possibly damaging Het
Pde5a G T 3: 122,803,032 G456V probably damaging Het
Qser1 T C 2: 104,786,574 T1298A probably benign Het
Rapgef5 T C 12: 117,721,329 V303A probably damaging Het
Rbbp6 T G 7: 122,988,724 M267R probably damaging Het
Rfx8 C A 1: 39,682,953 V291F probably damaging Het
Rnf121 T C 7: 102,023,348 K276R probably null Het
Rtca G T 3: 116,489,282 Y352* probably null Het
Sacs T C 14: 61,206,100 V1865A probably damaging Het
Sclt1 C T 3: 41,657,275 E521K probably benign Het
Setd1a T C 7: 127,797,248 probably null Het
Slc37a4 G T 9: 44,402,097 V337L probably benign Het
Slc5a9 G T 4: 111,893,169 S79* probably null Het
Snrpd2 T C 7: 19,151,322 V36A probably benign Het
Spata31d1b A T 13: 59,716,672 N545Y probably damaging Het
Sstr4 CGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 2: 148,395,551 probably benign Het
St7 G A 6: 17,834,674 V98I possibly damaging Het
Strip2 A T 6: 29,927,624 I223F probably benign Het
Syn2 A C 6: 115,278,352 N542H possibly damaging Het
Tbc1d2b T C 9: 90,227,443 T327A probably benign Het
Timm44 A T 8: 4,269,992 F59I possibly damaging Het
Tmem41b A T 7: 109,982,763 C44* probably null Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 11: 94,214,452 probably benign Het
Tusc3 A T 8: 39,130,793 K188* probably null Het
Usp39 T A 6: 72,328,687 Q371L probably benign Het
Vmn2r13 G T 5: 109,173,714 N372K probably damaging Het
Zfp961 T A 8: 71,968,059 Y139N probably damaging Het
Other mutations in Olfr351
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01962:Olfr351 APN 2 36859775 missense probably benign 0.04
IGL02481:Olfr351 APN 2 36859818 missense probably damaging 0.96
IGL02673:Olfr351 APN 2 36860176 missense probably benign 0.25
IGL02754:Olfr351 APN 2 36860220 missense probably damaging 1.00
P0041:Olfr351 UTSW 2 36859461 missense probably damaging 1.00
R1392:Olfr351 UTSW 2 36860175 missense probably damaging 1.00
R1392:Olfr351 UTSW 2 36860175 missense probably damaging 1.00
R2271:Olfr351 UTSW 2 36859625 missense probably damaging 1.00
R2274:Olfr351 UTSW 2 36860101 missense probably damaging 0.99
R3053:Olfr351 UTSW 2 36859947 missense probably benign 0.06
R4712:Olfr351 UTSW 2 36860369 splice site probably null
R5001:Olfr351 UTSW 2 36860070 missense probably benign 0.00
R5364:Olfr351 UTSW 2 36859994 missense probably damaging 1.00
R6048:Olfr351 UTSW 2 36859841 missense probably benign 0.00
R6401:Olfr351 UTSW 2 36860165 nonsense probably null
R7353:Olfr351 UTSW 2 36859668 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCACCTTGTCTGAACATTAAAC -3'
(R):5'- CCCAATGGTAGGAAACATTAGGAC -3'

Sequencing Primer
(F):5'- CAACATCTTGGTCACTGTAGATG -3'
(R):5'- TGGTAGGAAACATTAGGACTAGGAG -3'
Posted On2016-10-05