Incidental Mutation 'R5506:1110002E22Rik'
ID430909
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene NameRIKEN cDNA 1110002E22 gene
Synonyms
MMRRC Submission 043067-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R5506 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location138065052-138081506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 138067947 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 966 (G966W)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]
Predicted Effect probably benign
Transcript: ENSMUST00000053318
Predicted Effect probably damaging
Transcript: ENSMUST00000163080
AA Change: G966W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: G966W

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184925
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,188,956 probably benign Het
A930009A15Rik G T 10: 115,578,362 probably null Het
Cant1 G T 11: 118,411,442 H16Q probably benign Het
Capn3 G T 2: 120,502,420 V612F probably damaging Het
Cep112 A T 11: 108,664,603 E482D probably damaging Het
Cept1 A G 3: 106,531,248 V173A probably benign Het
CN725425 A G 15: 91,235,826 D50G possibly damaging Het
Cubn A T 2: 13,491,695 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dpp8 A G 9: 65,078,109 probably null Het
Ecm1 G A 3: 95,735,857 T377I probably benign Het
Exosc8 A G 3: 54,731,179 probably benign Het
Fam129b G A 2: 32,920,982 V335M probably damaging Het
Fam71f1 G A 6: 29,319,298 E34K probably damaging Het
Fasn C T 11: 120,809,510 D2165N probably benign Het
Gab2 A G 7: 97,303,113 E571G probably damaging Het
Galnt5 C A 2: 57,999,625 H412Q probably benign Het
Galr1 T A 18: 82,405,864 Y96F possibly damaging Het
Gm8882 T C 6: 132,361,856 N133S unknown Het
Gnl2 C A 4: 125,055,365 probably benign Het
H2afx T C 9: 44,335,105 V115A probably benign Het
Heatr9 T C 11: 83,514,766 N317S possibly damaging Het
Hist1h2an A C 13: 21,786,911 I103S probably damaging Het
Kndc1 A G 7: 139,927,891 Y1254C probably damaging Het
Lrp6 A T 6: 134,459,296 D1302E probably benign Het
Mc2r A T 18: 68,407,948 Y91* probably null Het
Meis1 T G 11: 18,941,747 D267A possibly damaging Het
Mki67 T C 7: 135,699,981 K1108R possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh3 T G 11: 67,084,089 D219E probably damaging Het
Olfr1511 T C 14: 52,390,627 I49V probably damaging Het
Olfr857 T C 9: 19,713,274 L149P possibly damaging Het
Pi4ka A G 16: 17,293,953 C1553R probably damaging Het
Plekhb1 C A 7: 100,644,943 C241F probably null Het
Polr3d A T 14: 70,440,759 D165E possibly damaging Het
Psmb1 A G 17: 15,490,216 Y124H probably damaging Het
Rab11fip5 A G 6: 85,374,137 L131P probably damaging Het
Raph1 A T 1: 60,493,498 probably benign Het
Scgb2b27 T G 7: 34,012,059 probably benign Het
Serpina10 T C 12: 103,626,661 D318G probably damaging Het
Sftpb A G 6: 72,304,667 T15A possibly damaging Het
Slc20a1 T C 2: 129,210,819 F674L probably benign Het
Syne2 A T 12: 75,938,721 N1648Y probably benign Het
Thsd7a G T 6: 12,332,017 N1265K possibly damaging Het
Trem2 T C 17: 48,351,774 L189P probably benign Het
Washc4 A T 10: 83,581,337 R865S probably damaging Het
Zfp536 A G 7: 37,568,792 S400P probably damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 138067980 missense probably damaging 1.00
R6457:1110002E22Rik UTSW 3 138066622 missense probably damaging 1.00
R6469:1110002E22Rik UTSW 3 138066975 missense probably damaging 0.97
R6499:1110002E22Rik UTSW 3 138068800 missense probably damaging 1.00
R6527:1110002E22Rik UTSW 3 138067527 missense probably damaging 0.99
R6580:1110002E22Rik UTSW 3 138066625 missense probably benign 0.00
R6693:1110002E22Rik UTSW 3 138069154 missense probably benign 0.00
R6751:1110002E22Rik UTSW 3 138066210 missense probably damaging 1.00
R6852:1110002E22Rik UTSW 3 138065169 nonsense probably null
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTCTCCGATGGACACAC -3'
(R):5'- TGAAGTCTGAGCTTGGCTGC -3'

Sequencing Primer
(F):5'- TCTCCGATGGACACACAGAAGTATG -3'
(R):5'- AGCTTGGCTGCTGTACAC -3'
Posted OnOct 05, 2016