Incidental Mutation 'R5506:Dpp8'
ID430927
Institutional Source Beutler Lab
Gene Symbol Dpp8
Ensembl Gene ENSMUSG00000032393
Gene Namedipeptidylpeptidase 8
Synonyms2310004I03Rik, 4932434F09Rik
MMRRC Submission 043067-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.373) question?
Stock #R5506 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location65032414-65082651 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 65078109 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034960] [ENSMUST00000167773] [ENSMUST00000217434]
Predicted Effect probably null
Transcript: ENSMUST00000034960
SMART Domains Protein: ENSMUSP00000034960
Gene: ENSMUSG00000032393

DomainStartEndE-ValueType
low complexity region 144 154 N/A INTRINSIC
Pfam:DPPIV_N 168 589 1e-100 PFAM
Pfam:Peptidase_S15 636 830 7.3e-11 PFAM
Pfam:Abhydrolase_5 671 860 4.8e-9 PFAM
Pfam:Peptidase_S9 676 885 6.5e-62 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167773
SMART Domains Protein: ENSMUSP00000126065
Gene: ENSMUSG00000032393

DomainStartEndE-ValueType
low complexity region 144 154 N/A INTRINSIC
Pfam:DPPIV_N 168 589 3.3e-102 PFAM
Pfam:Peptidase_S15 636 830 7.3e-11 PFAM
Pfam:Abhydrolase_5 670 860 6.5e-9 PFAM
Pfam:Peptidase_S9 677 885 8.6e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217328
Predicted Effect probably benign
Transcript: ENSMUST00000217434
Meta Mutation Damage Score 0.6164 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S9B family, a small family of dipeptidyl peptidases that are able to cleave peptide substrates at a prolyl bond. The encoded protein shares similarity with dipeptidyl peptidase IV in that it is ubiquitously expressed, and hydrolyzes the same substrates. These similarities suggest that, like dipeptidyl peptidase IV, this protein may play a role in T-cell activation and immune function. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,067,947 G966W probably damaging Het
3110002H16Rik A G 18: 12,188,956 probably benign Het
A930009A15Rik G T 10: 115,578,362 probably null Het
Cant1 G T 11: 118,411,442 H16Q probably benign Het
Capn3 G T 2: 120,502,420 V612F probably damaging Het
Cep112 A T 11: 108,664,603 E141D probably damaging Het
Cept1 A G 3: 106,531,248 V173A probably benign Het
CN725425 A G 15: 91,235,826 D50G possibly damaging Het
Cubn A T 2: 13,491,695 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Ecm1 G A 3: 95,735,857 T377I probably benign Het
Exosc8 A G 3: 54,731,179 probably benign Het
Fam129b G A 2: 32,920,982 V335M probably damaging Het
Fam71f1 G A 6: 29,319,298 E34K probably damaging Het
Fasn C T 11: 120,809,510 D2165N probably benign Het
Gab2 A G 7: 97,303,113 E571G probably damaging Het
Galnt5 C A 2: 57,999,625 H412Q probably benign Het
Galr1 T A 18: 82,405,864 Y96F possibly damaging Het
Gm8882 T C 6: 132,361,856 N133S unknown Het
Gnl2 C A 4: 125,055,365 probably benign Het
H2afx T C 9: 44,335,105 V115A probably benign Het
Heatr9 T C 11: 83,514,766 N317S possibly damaging Het
Hist1h2an A C 13: 21,786,911 I103S probably damaging Het
Kndc1 A G 7: 139,927,891 Y1254C probably damaging Het
Lrp6 A T 6: 134,459,296 D1302E probably benign Het
Mc2r A T 18: 68,407,948 Y91* probably null Het
Meis1 T G 11: 18,941,747 D267A possibly damaging Het
Mki67 T C 7: 135,699,981 K1108R possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh3 T G 11: 67,084,089 D219E probably damaging Het
Olfr1511 T C 14: 52,390,627 I49V probably damaging Het
Olfr857 T C 9: 19,713,274 L149P possibly damaging Het
Pi4ka A G 16: 17,293,953 C1553R probably damaging Het
Plekhb1 C A 7: 100,644,943 probably null Het
Polr3d A T 14: 70,440,759 D165E possibly damaging Het
Psmb1 A G 17: 15,490,216 Y24H probably damaging Het
Rab11fip5 A G 6: 85,374,137 L131P probably damaging Het
Raph1 A T 1: 60,493,498 probably benign Het
Scgb2b27 T G 7: 34,012,059 probably benign Het
Serpina10 T C 12: 103,626,661 D264G probably damaging Het
Sftpb A G 6: 72,304,667 T15A possibly damaging Het
Slc20a1 T C 2: 129,210,819 F674L probably benign Het
Syne2 A T 12: 75,938,721 N1648Y probably benign Het
Thsd7a G T 6: 12,332,017 N1265K possibly damaging Het
Trem2 T C 17: 48,351,774 L189P probably benign Het
Washc4 A T 10: 83,581,337 R865S probably damaging Het
Zfp536 A G 7: 37,568,792 S400P probably damaging Het
Other mutations in Dpp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Dpp8 APN 9 65078008 missense probably damaging 1.00
IGL00576:Dpp8 APN 9 65043829 missense probably benign 0.32
IGL01303:Dpp8 APN 9 65055012 splice site probably benign
IGL01506:Dpp8 APN 9 65063417 splice site probably benign
IGL01544:Dpp8 APN 9 65054988 missense probably benign 0.05
IGL02387:Dpp8 APN 9 65045716 missense probably damaging 1.00
IGL02567:Dpp8 APN 9 65078776 nonsense probably null
IGL02611:Dpp8 APN 9 65055793 missense probably benign 0.15
IGL02723:Dpp8 APN 9 65042267 missense possibly damaging 0.91
IGL02927:Dpp8 APN 9 65060269 missense probably benign 0.09
IGL03116:Dpp8 APN 9 65066467 missense probably damaging 0.96
IGL03135:Dpp8 APN 9 65053040 splice site probably null
IGL03356:Dpp8 APN 9 65045787 missense probably benign 0.00
IGL03050:Dpp8 UTSW 9 65054836 missense probably benign 0.00
R0498:Dpp8 UTSW 9 65045795 splice site probably benign
R0594:Dpp8 UTSW 9 65036998 missense probably damaging 1.00
R0675:Dpp8 UTSW 9 65066502 splice site probably benign
R0699:Dpp8 UTSW 9 65054894 missense probably benign 0.01
R0831:Dpp8 UTSW 9 65078679 missense possibly damaging 0.56
R1148:Dpp8 UTSW 9 65053832 critical splice donor site probably null
R1148:Dpp8 UTSW 9 65053832 critical splice donor site probably null
R1512:Dpp8 UTSW 9 65063814 splice site probably benign
R1515:Dpp8 UTSW 9 65078748 missense probably benign 0.04
R1546:Dpp8 UTSW 9 65063493 missense possibly damaging 0.76
R1556:Dpp8 UTSW 9 65051479 missense probably damaging 1.00
R2027:Dpp8 UTSW 9 65078774 missense probably damaging 1.00
R2104:Dpp8 UTSW 9 65074567 synonymous probably null
R2113:Dpp8 UTSW 9 65063868 missense probably benign 0.00
R2656:Dpp8 UTSW 9 65080804 missense probably damaging 1.00
R4237:Dpp8 UTSW 9 65054923 missense probably benign
R4238:Dpp8 UTSW 9 65054923 missense probably benign
R4239:Dpp8 UTSW 9 65054923 missense probably benign
R4595:Dpp8 UTSW 9 65075803 missense probably damaging 1.00
R4614:Dpp8 UTSW 9 65066396 missense probably benign 0.00
R4946:Dpp8 UTSW 9 65055918 missense probably benign 0.00
R5338:Dpp8 UTSW 9 65063924 nonsense probably null
R5378:Dpp8 UTSW 9 65078014 missense probably damaging 1.00
R5644:Dpp8 UTSW 9 65045735 nonsense probably null
R5862:Dpp8 UTSW 9 65045722 missense probably benign 0.03
R6437:Dpp8 UTSW 9 65074578 missense probably benign 0.01
R6783:Dpp8 UTSW 9 65063562 missense possibly damaging 0.76
R6863:Dpp8 UTSW 9 65035008 missense probably damaging 0.98
R7192:Dpp8 UTSW 9 65045786 missense possibly damaging 0.70
R7461:Dpp8 UTSW 9 65053120 missense possibly damaging 0.86
R7514:Dpp8 UTSW 9 65078754 missense not run
R7548:Dpp8 UTSW 9 65037235 missense not run
Predicted Primers PCR Primer
(F):5'- TTCCGGGACACAACTAACTG -3'
(R):5'- TGGCTCTGAGTGCTACTCTAG -3'

Sequencing Primer
(F):5'- AACTGTCCATGGTCTCATATGCAGG -3'
(R):5'- ACTCTAGACGGTTTAGCAGC -3'
Posted On2016-10-05