Incidental Mutation 'R5506:Meis1'
ID430932
Institutional Source Beutler Lab
Gene Symbol Meis1
Ensembl Gene ENSMUSG00000020160
Gene NameMeis homeobox 1
SynonymsC530044H18Rik
MMRRC Submission 043067-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5506 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location18879817-19018985 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 18941747 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 267 (D267A)
Ref Sequence ENSEMBL: ENSMUSP00000135726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068264] [ENSMUST00000102878] [ENSMUST00000144988] [ENSMUST00000177417] [ENSMUST00000185131]
Predicted Effect probably benign
Transcript: ENSMUST00000068264
AA Change: D267A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000069277
Gene: ENSMUSG00000020160
AA Change: D267A

DomainStartEndE-ValueType
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
low complexity region 372 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102878
AA Change: D267A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000099942
Gene: ENSMUSG00000020160
AA Change: D267A

DomainStartEndE-ValueType
internal_repeat_1 12 59 8.66e-5 PROSPERO
Pfam:Meis_PKNOX_N 108 192 5.5e-48 PFAM
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
internal_repeat_1 384 428 8.66e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118661
SMART Domains Protein: ENSMUSP00000112809
Gene: ENSMUSG00000020160

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
HOX 92 157 5.3e-14 SMART
low complexity region 192 205 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000144988
AA Change: D267A

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134969
Gene: ENSMUSG00000020160
AA Change: D267A

DomainStartEndE-ValueType
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
low complexity region 358 369 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177357
Predicted Effect possibly damaging
Transcript: ENSMUST00000177417
AA Change: D267A

PolyPhen 2 Score 0.521 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135726
Gene: ENSMUSG00000020160
AA Change: D267A

DomainStartEndE-ValueType
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185131
AA Change: D267A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139219
Gene: ENSMUSG00000020160
AA Change: D267A

DomainStartEndE-ValueType
internal_repeat_1 12 59 8.66e-5 PROSPERO
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
internal_repeat_1 384 428 8.66e-5 PROSPERO
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Homozygous mutant mice die during gestation and exhibit eye, vasculature, and hematopoietic defects. Mice homozygous for a conditional allele activated in HSCs exhibit altered bone marrow cell development, altered HSC physiology and increased reactive oxygen species production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,067,947 G966W probably damaging Het
3110002H16Rik A G 18: 12,188,956 probably benign Het
A930009A15Rik G T 10: 115,578,362 probably null Het
Cant1 G T 11: 118,411,442 H16Q probably benign Het
Capn3 G T 2: 120,502,420 V612F probably damaging Het
Cep112 A T 11: 108,664,603 E141D probably damaging Het
Cept1 A G 3: 106,531,248 V173A probably benign Het
CN725425 A G 15: 91,235,826 D50G possibly damaging Het
Cubn A T 2: 13,491,695 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dpp8 A G 9: 65,078,109 probably null Het
Ecm1 G A 3: 95,735,857 T377I probably benign Het
Exosc8 A G 3: 54,731,179 probably benign Het
Fam129b G A 2: 32,920,982 V335M probably damaging Het
Fam71f1 G A 6: 29,319,298 E34K probably damaging Het
Fasn C T 11: 120,809,510 D2165N probably benign Het
Gab2 A G 7: 97,303,113 E571G probably damaging Het
Galnt5 C A 2: 57,999,625 H412Q probably benign Het
Galr1 T A 18: 82,405,864 Y96F possibly damaging Het
Gm8882 T C 6: 132,361,856 N133S unknown Het
Gnl2 C A 4: 125,055,365 probably benign Het
H2afx T C 9: 44,335,105 V115A probably benign Het
Heatr9 T C 11: 83,514,766 N317S possibly damaging Het
Hist1h2an A C 13: 21,786,911 I103S probably damaging Het
Kndc1 A G 7: 139,927,891 Y1254C probably damaging Het
Lrp6 A T 6: 134,459,296 D1302E probably benign Het
Mc2r A T 18: 68,407,948 Y91* probably null Het
Mki67 T C 7: 135,699,981 K1108R possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh3 T G 11: 67,084,089 D219E probably damaging Het
Olfr1511 T C 14: 52,390,627 I49V probably damaging Het
Olfr857 T C 9: 19,713,274 L149P possibly damaging Het
Pi4ka A G 16: 17,293,953 C1553R probably damaging Het
Plekhb1 C A 7: 100,644,943 probably null Het
Polr3d A T 14: 70,440,759 D165E possibly damaging Het
Psmb1 A G 17: 15,490,216 Y24H probably damaging Het
Rab11fip5 A G 6: 85,374,137 L131P probably damaging Het
Raph1 A T 1: 60,493,498 probably benign Het
Scgb2b27 T G 7: 34,012,059 probably benign Het
Serpina10 T C 12: 103,626,661 D264G probably damaging Het
Sftpb A G 6: 72,304,667 T15A possibly damaging Het
Slc20a1 T C 2: 129,210,819 F674L probably benign Het
Syne2 A T 12: 75,938,721 N1648Y probably benign Het
Thsd7a G T 6: 12,332,017 N1265K possibly damaging Het
Trem2 T C 17: 48,351,774 L189P probably benign Het
Washc4 A T 10: 83,581,337 R865S probably damaging Het
Zfp536 A G 7: 37,568,792 S400P probably damaging Het
Other mutations in Meis1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01927:Meis1 APN 11 18881811 missense probably benign 0.25
IGL02156:Meis1 APN 11 19011292 missense probably benign 0.03
IGL02376:Meis1 APN 11 18881752 missense probably benign 0.06
R0505:Meis1 UTSW 11 19011360 missense probably damaging 0.99
R0833:Meis1 UTSW 11 18881767 missense possibly damaging 0.91
R1477:Meis1 UTSW 11 18881665 nonsense probably null
R1512:Meis1 UTSW 11 18881682 missense probably damaging 0.97
R1643:Meis1 UTSW 11 19016278 missense probably benign 0.00
R1717:Meis1 UTSW 11 19010608 intron probably benign
R2117:Meis1 UTSW 11 18881679 missense probably damaging 1.00
R2342:Meis1 UTSW 11 18881647 missense probably damaging 1.00
R2426:Meis1 UTSW 11 18988356 missense possibly damaging 0.64
R3076:Meis1 UTSW 11 19011254 missense probably benign 0.01
R3078:Meis1 UTSW 11 19011254 missense probably benign 0.01
R4368:Meis1 UTSW 11 19010656 intron probably benign
R4915:Meis1 UTSW 11 19009222 intron probably benign
R4916:Meis1 UTSW 11 18881776 missense possibly damaging 0.91
R4917:Meis1 UTSW 11 19009222 intron probably benign
R4918:Meis1 UTSW 11 19009222 intron probably benign
R4948:Meis1 UTSW 11 19016308 missense probably benign 0.00
R5093:Meis1 UTSW 11 18881785 missense probably benign 0.13
R5507:Meis1 UTSW 11 19016168 missense probably benign 0.27
R5521:Meis1 UTSW 11 18988260 splice site probably benign
R5673:Meis1 UTSW 11 19012812 missense probably damaging 1.00
R5813:Meis1 UTSW 11 19016229 missense probably benign 0.11
R6347:Meis1 UTSW 11 18905631 intron probably null
R6354:Meis1 UTSW 11 19016184 missense possibly damaging 0.89
R6383:Meis1 UTSW 11 18941741 missense probably benign
R6624:Meis1 UTSW 11 19016215 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACAGTGATGTAGGAAGCGC -3'
(R):5'- GATGGATATTTCCCTCCAGTCC -3'

Sequencing Primer
(F):5'- TGTAGGAAGCGCAGAGGGATC -3'
(R):5'- AGTTGAGACCTTGTTCTTTCTCTTTG -3'
Posted On2016-10-05