Incidental Mutation 'R5506:Hist1h2an'
ID430940
Institutional Source Beutler Lab
Gene Symbol Hist1h2an
Ensembl Gene ENSMUSG00000069309
Gene Namehistone cluster 1, H2an
Synonyms
MMRRC Submission 043067-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R5506 (G1)
Quality Score188
Status Not validated
Chromosome13
Chromosomal Location21786826-21787218 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 21786911 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 103 (I103S)
Ref Sequence ENSEMBL: ENSMUSP00000089345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091751] [ENSMUST00000102982] [ENSMUST00000110473] [ENSMUST00000189457]
Predicted Effect probably damaging
Transcript: ENSMUST00000091751
AA Change: I103S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089345
Gene: ENSMUSG00000069309
AA Change: I103S

DomainStartEndE-ValueType
H2A 3 123 8.07e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102982
SMART Domains Protein: ENSMUSP00000100047
Gene: ENSMUSG00000069308

DomainStartEndE-ValueType
H2B 28 124 4.64e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110473
SMART Domains Protein: ENSMUSP00000106099
Gene: ENSMUSG00000069308

DomainStartEndE-ValueType
H2B 28 124 4.64e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189457
SMART Domains Protein: ENSMUSP00000139663
Gene: ENSMUSG00000101972

DomainStartEndE-ValueType
H3 34 136 1.5e-75 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198851
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,067,947 G966W probably damaging Het
3110002H16Rik A G 18: 12,188,956 probably benign Het
A930009A15Rik G T 10: 115,578,362 probably null Het
Cant1 G T 11: 118,411,442 H16Q probably benign Het
Capn3 G T 2: 120,502,420 V612F probably damaging Het
Cep112 A T 11: 108,664,603 E141D probably damaging Het
Cept1 A G 3: 106,531,248 V173A probably benign Het
CN725425 A G 15: 91,235,826 D50G possibly damaging Het
Cubn A T 2: 13,491,695 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dpp8 A G 9: 65,078,109 probably null Het
Ecm1 G A 3: 95,735,857 T377I probably benign Het
Exosc8 A G 3: 54,731,179 probably benign Het
Fam129b G A 2: 32,920,982 V335M probably damaging Het
Fam71f1 G A 6: 29,319,298 E34K probably damaging Het
Fasn C T 11: 120,809,510 D2165N probably benign Het
Gab2 A G 7: 97,303,113 E571G probably damaging Het
Galnt5 C A 2: 57,999,625 H412Q probably benign Het
Galr1 T A 18: 82,405,864 Y96F possibly damaging Het
Gm8882 T C 6: 132,361,856 N133S unknown Het
Gnl2 C A 4: 125,055,365 probably benign Het
H2afx T C 9: 44,335,105 V115A probably benign Het
Heatr9 T C 11: 83,514,766 N317S possibly damaging Het
Kndc1 A G 7: 139,927,891 Y1254C probably damaging Het
Lrp6 A T 6: 134,459,296 D1302E probably benign Het
Mc2r A T 18: 68,407,948 Y91* probably null Het
Meis1 T G 11: 18,941,747 D267A possibly damaging Het
Mki67 T C 7: 135,699,981 K1108R possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh3 T G 11: 67,084,089 D219E probably damaging Het
Olfr1511 T C 14: 52,390,627 I49V probably damaging Het
Olfr857 T C 9: 19,713,274 L149P possibly damaging Het
Pi4ka A G 16: 17,293,953 C1553R probably damaging Het
Plekhb1 C A 7: 100,644,943 probably null Het
Polr3d A T 14: 70,440,759 D165E possibly damaging Het
Psmb1 A G 17: 15,490,216 Y24H probably damaging Het
Rab11fip5 A G 6: 85,374,137 L131P probably damaging Het
Raph1 A T 1: 60,493,498 probably benign Het
Scgb2b27 T G 7: 34,012,059 probably benign Het
Serpina10 T C 12: 103,626,661 D264G probably damaging Het
Sftpb A G 6: 72,304,667 T15A possibly damaging Het
Slc20a1 T C 2: 129,210,819 F674L probably benign Het
Syne2 A T 12: 75,938,721 N1648Y probably benign Het
Thsd7a G T 6: 12,332,017 N1265K possibly damaging Het
Trem2 T C 17: 48,351,774 L189P probably benign Het
Washc4 A T 10: 83,581,337 R865S probably damaging Het
Zfp536 A G 7: 37,568,792 S400P probably damaging Het
Other mutations in Hist1h2an
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Hist1h2an APN 13 21786921 missense probably benign 0.43
R3885:Hist1h2an UTSW 13 21786869 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGATCGGAGAAACAGATTCCTTC -3'
(R):5'- AATGTCTGGACGCGGCAAAC -3'

Sequencing Primer
(F):5'- TCGGAGAAACAGATTCCTTCTATAG -3'
(R):5'- CAAGGGCAACTACTCGGAGC -3'
Posted On2016-10-05