Incidental Mutation 'R5507:Samd9l'
ID430974
Institutional Source Beutler Lab
Gene Symbol Samd9l
Ensembl Gene ENSMUSG00000047735
Gene Namesterile alpha motif domain containing 9-like
SynonymsESTM25
MMRRC Submission 043068-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5507 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location3372257-3399572 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3373898 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1121 (E1121G)
Ref Sequence ENSEMBL: ENSMUSP00000112688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]
Predicted Effect possibly damaging
Transcript: ENSMUST00000120087
AA Change: E1121G

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: E1121G

DomainStartEndE-ValueType
SCOP:d1kw4a_ 8 75 4e-8 SMART
Blast:SAM 11 75 1e-30 BLAST
low complexity region 96 115 N/A INTRINSIC
low complexity region 385 397 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201638
SMART Domains Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735

DomainStartEndE-ValueType
Pfam:Ste50p-SAM 10 80 1.2e-8 PFAM
Pfam:SAM_2 11 68 8.7e-6 PFAM
Pfam:SAM_1 12 71 2.5e-7 PFAM
Meta Mutation Damage Score 0.052 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.2%
Validation Efficiency 100% (66/66)
MGI Phenotype PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A G 4: 39,451,084 T97A probably damaging Het
1700017N19Rik T C 10: 100,609,233 S27P probably benign Het
Acoxl C A 2: 127,884,474 A256E probably damaging Het
Akap9 A G 5: 3,968,683 E1088G probably benign Het
Alox12 T C 11: 70,254,412 T112A possibly damaging Het
Ampd2 A G 3: 108,077,613 V379A probably damaging Het
Ap4e1 C A 2: 127,008,898 H49N probably damaging Het
Arhgap11a T C 2: 113,841,678 T260A probably benign Het
Atg2a T C 19: 6,245,070 F171S possibly damaging Het
Bpifb9b A T 2: 154,317,027 Y488F possibly damaging Het
C2cd2 T C 16: 97,881,620 T139A probably benign Het
Cct8l1 A T 5: 25,516,379 T31S probably benign Het
Cdhr1 A T 14: 37,082,845 N469K probably damaging Het
Chga T C 12: 102,562,609 S282P probably benign Het
Chrnb4 T G 9: 55,035,012 H326P probably damaging Het
Cntnap1 A G 11: 101,183,477 T748A probably benign Het
Cpsf3 T A 12: 21,297,928 L250H probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dppa5a T A 9: 78,368,071 D10V possibly damaging Het
Dsc2 G A 18: 20,046,279 T244I probably damaging Het
Elavl4 T C 4: 110,213,206 T144A probably benign Het
Ephb1 C T 9: 101,936,116 V776M probably damaging Het
Fcrl1 C T 3: 87,391,242 S348F probably benign Het
Fga T A 3: 83,033,336 W766R probably damaging Het
Galnt14 A G 17: 73,495,666 V477A probably damaging Het
Gcdh A G 8: 84,892,857 L103P probably damaging Het
Gm27013 G A 6: 130,675,979 T840I probably damaging Het
Gpr179 A T 11: 97,338,330 W1000R probably damaging Het
Hectd4 C T 5: 121,281,101 A581V unknown Het
Ints12 T A 3: 133,109,160 V376E probably damaging Het
Krt77 T C 15: 101,861,230 I402V probably benign Het
March1 T C 8: 66,418,890 V102A probably damaging Het
Meis1 A T 11: 19,016,168 N68K probably benign Het
Mthfd1l A G 10: 4,106,432 E916G probably benign Het
Muc5ac T C 7: 141,807,832 F1627L possibly damaging Het
Myef2 A T 2: 125,116,703 M102K probably benign Het
Naip6 A C 13: 100,298,915 H1033Q probably benign Het
Nid1 T A 13: 13,489,037 C760* probably null Het
Nt5dc1 A T 10: 34,397,230 C191S probably benign Het
Nup214 A G 2: 31,988,176 E285G possibly damaging Het
Nvl A G 1: 181,135,036 L123P probably damaging Het
Olfr1094 T A 2: 86,829,317 H188Q probably damaging Het
Otog A G 7: 46,261,699 E658G probably damaging Het
Pam16 G T 16: 4,618,016 probably benign Het
Psg17 T C 7: 18,819,926 D133G probably benign Het
Rabgap1l A G 1: 160,351,328 S21P possibly damaging Het
Rgs22 T A 15: 36,099,652 M306L probably damaging Het
Ruvbl1 A G 6: 88,467,600 K59R probably benign Het
Serpinb13 A G 1: 106,998,602 N169S probably benign Het
Setbp1 T A 18: 79,086,712 T102S probably damaging Het
Syn3 A T 10: 86,080,226 S299T probably benign Het
Taar7a A G 10: 23,992,631 L284P probably damaging Het
Tlr6 C A 5: 64,953,406 Q719H probably damaging Het
Tmem131 T A 1: 36,889,280 D76V probably damaging Het
Tradd T G 8: 105,259,625 D145A possibly damaging Het
Usp20 A T 2: 31,010,226 M251L probably benign Het
Vmn2r96 T A 17: 18,597,829 L556Q probably damaging Het
Xrcc2 A G 5: 25,692,319 S211P probably benign Het
Other mutations in Samd9l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Samd9l APN 6 3376779 missense probably damaging 0.96
IGL00550:Samd9l APN 6 3374594 missense probably benign 0.00
IGL01100:Samd9l APN 6 3375863 missense possibly damaging 0.91
IGL01321:Samd9l APN 6 3376259 missense probably benign 0.42
IGL01553:Samd9l APN 6 3375566 missense probably damaging 0.99
IGL01575:Samd9l APN 6 3376734 missense possibly damaging 0.85
IGL01896:Samd9l APN 6 3375120 missense probably benign 0.02
IGL01915:Samd9l APN 6 3373864 nonsense probably null
IGL02063:Samd9l APN 6 3372992 missense probably damaging 1.00
IGL02066:Samd9l APN 6 3376575 missense probably damaging 1.00
IGL02145:Samd9l APN 6 3374105 missense probably benign 0.13
IGL02163:Samd9l APN 6 3374246 missense possibly damaging 0.90
IGL02256:Samd9l APN 6 3376197 missense probably damaging 1.00
IGL02508:Samd9l APN 6 3374798 missense probably damaging 1.00
IGL02591:Samd9l APN 6 3375760 missense possibly damaging 0.91
IGL02968:Samd9l APN 6 3376026 missense probably damaging 1.00
IGL03058:Samd9l APN 6 3374980 missense probably damaging 0.99
IGL03068:Samd9l APN 6 3375348 nonsense probably null
IGL03160:Samd9l APN 6 3374894 missense probably damaging 1.00
IGL03372:Samd9l APN 6 3375314 missense probably damaging 1.00
IGL03385:Samd9l APN 6 3376208 missense probably damaging 0.99
boston_lager UTSW 6 3375761 missense probably benign 0.12
ipa UTSW 6 3376347 missense probably damaging 1.00
IGL03054:Samd9l UTSW 6 3376023 missense probably damaging 1.00
R0111:Samd9l UTSW 6 3374946 missense possibly damaging 0.80
R0112:Samd9l UTSW 6 3376031 missense possibly damaging 0.93
R0356:Samd9l UTSW 6 3375107 missense possibly damaging 0.69
R0370:Samd9l UTSW 6 3377264 start gained probably benign
R0398:Samd9l UTSW 6 3374502 missense probably damaging 1.00
R0744:Samd9l UTSW 6 3372725 missense possibly damaging 0.92
R0833:Samd9l UTSW 6 3372725 missense possibly damaging 0.92
R0880:Samd9l UTSW 6 3377064 missense probably damaging 1.00
R1110:Samd9l UTSW 6 3374267 missense probably benign 0.44
R1155:Samd9l UTSW 6 3376939 missense probably benign 0.01
R1268:Samd9l UTSW 6 3376113 missense possibly damaging 0.56
R1293:Samd9l UTSW 6 3373947 missense possibly damaging 0.93
R1478:Samd9l UTSW 6 3376369 missense probably benign 0.06
R1573:Samd9l UTSW 6 3375426 missense probably damaging 0.99
R1590:Samd9l UTSW 6 3375761 missense probably benign 0.12
R1611:Samd9l UTSW 6 3373771 missense probably benign 0.00
R1754:Samd9l UTSW 6 3373126 missense probably damaging 0.96
R1759:Samd9l UTSW 6 3373401 missense probably damaging 1.00
R1795:Samd9l UTSW 6 3375264 nonsense probably null
R1829:Samd9l UTSW 6 3375107 missense possibly damaging 0.69
R1935:Samd9l UTSW 6 3376269 missense probably benign 0.01
R2154:Samd9l UTSW 6 3372945 missense possibly damaging 0.91
R2228:Samd9l UTSW 6 3376910 missense probably benign 0.08
R3622:Samd9l UTSW 6 3374032 nonsense probably null
R3903:Samd9l UTSW 6 3376830 nonsense probably null
R3904:Samd9l UTSW 6 3376830 nonsense probably null
R3945:Samd9l UTSW 6 3377029 missense possibly damaging 0.71
R4091:Samd9l UTSW 6 3376887 missense probably benign 0.22
R4602:Samd9l UTSW 6 3373935 missense probably damaging 1.00
R4602:Samd9l UTSW 6 3373937 frame shift probably null
R4618:Samd9l UTSW 6 3376347 missense probably damaging 1.00
R4747:Samd9l UTSW 6 3375504 nonsense probably null
R4762:Samd9l UTSW 6 3375623 missense probably benign 0.01
R4814:Samd9l UTSW 6 3372863 missense probably damaging 0.98
R4934:Samd9l UTSW 6 3375621 nonsense probably null
R5026:Samd9l UTSW 6 3375284 missense possibly damaging 0.75
R5048:Samd9l UTSW 6 3374157 missense probably benign 0.35
R5130:Samd9l UTSW 6 3374548 missense possibly damaging 0.69
R5271:Samd9l UTSW 6 3376156 missense probably benign 0.02
R5328:Samd9l UTSW 6 3376739 missense probably damaging 0.99
R5587:Samd9l UTSW 6 3373291 missense possibly damaging 0.84
R5846:Samd9l UTSW 6 3376754 missense probably benign
R5881:Samd9l UTSW 6 3372716 missense possibly damaging 0.70
R5889:Samd9l UTSW 6 3376460 missense probably damaging 1.00
R6131:Samd9l UTSW 6 3377252 missense probably benign 0.00
R6199:Samd9l UTSW 6 3376686 missense probably benign 0.13
R6298:Samd9l UTSW 6 3375383 missense probably damaging 1.00
R6331:Samd9l UTSW 6 3376361 missense probably damaging 1.00
R6489:Samd9l UTSW 6 3376896 missense probably benign
R6601:Samd9l UTSW 6 3377229 missense possibly damaging 0.74
R6655:Samd9l UTSW 6 3377247 missense probably benign 0.22
R6803:Samd9l UTSW 6 3375446 missense probably damaging 0.97
R6864:Samd9l UTSW 6 3374750 missense probably benign 0.14
R6905:Samd9l UTSW 6 3375387 missense probably damaging 0.99
R6919:Samd9l UTSW 6 3376313 missense possibly damaging 0.88
R7060:Samd9l UTSW 6 3372716 missense probably damaging 0.99
R7073:Samd9l UTSW 6 3375856 nonsense probably null
R7250:Samd9l UTSW 6 3374201 missense possibly damaging 0.78
R7307:Samd9l UTSW 6 3372600 nonsense probably null
R7351:Samd9l UTSW 6 3374157 missense probably benign 0.35
R7423:Samd9l UTSW 6 3374408 missense probably damaging 1.00
X0026:Samd9l UTSW 6 3375560 missense probably damaging 1.00
X0066:Samd9l UTSW 6 3374477 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTATTTCTCCGAAGAAGCCG -3'
(R):5'- AAGGTCTTGATCGCAGGAAGTG -3'

Sequencing Primer
(F):5'- CGAAGAAGCCGGCTGTGTTG -3'
(R):5'- ATCGCAGGAAGTGATCGATTCCC -3'
Posted On2016-10-05