Incidental Mutation 'R5507:Psg17'
ID430977
Institutional Source Beutler Lab
Gene Symbol Psg17
Ensembl Gene ENSMUSG00000004540
Gene Namepregnancy specific glycoprotein 17
SynonymsmmCGM5, Cea-2, Cea2
MMRRC Submission 043068-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5507 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location18813937-18821607 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18819926 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 133 (D133G)
Ref Sequence ENSEMBL: ENSMUSP00000004655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004655]
Predicted Effect probably benign
Transcript: ENSMUST00000004655
AA Change: D133G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000004655
Gene: ENSMUSG00000004540
AA Change: D133G

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
IG 40 141 1.84e-2 SMART
IG 160 261 3.63e0 SMART
IG 280 381 2.03e-4 SMART
IGc2 397 461 2.35e-9 SMART
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.2%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A G 4: 39,451,084 T97A probably damaging Het
1700017N19Rik T C 10: 100,609,233 S27P probably benign Het
Acoxl C A 2: 127,884,474 A256E probably damaging Het
Akap9 A G 5: 3,968,683 E1088G probably benign Het
Alox12 T C 11: 70,254,412 T112A possibly damaging Het
Ampd2 A G 3: 108,077,613 V379A probably damaging Het
Ap4e1 C A 2: 127,008,898 H49N probably damaging Het
Arhgap11a T C 2: 113,841,678 T260A probably benign Het
Atg2a T C 19: 6,245,070 F171S possibly damaging Het
Bpifb9b A T 2: 154,317,027 Y488F possibly damaging Het
C2cd2 T C 16: 97,881,620 T139A probably benign Het
Cct8l1 A T 5: 25,516,379 T31S probably benign Het
Cdhr1 A T 14: 37,082,845 N469K probably damaging Het
Chga T C 12: 102,562,609 S282P probably benign Het
Chrnb4 T G 9: 55,035,012 H326P probably damaging Het
Cntnap1 A G 11: 101,183,477 T748A probably benign Het
Cpsf3 T A 12: 21,297,928 L250H probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dppa5a T A 9: 78,368,071 D10V possibly damaging Het
Dsc2 G A 18: 20,046,279 T244I probably damaging Het
Elavl4 T C 4: 110,213,206 T144A probably benign Het
Ephb1 C T 9: 101,936,116 V776M probably damaging Het
Fcrl1 C T 3: 87,391,242 S348F probably benign Het
Fga T A 3: 83,033,336 W766R probably damaging Het
Galnt14 A G 17: 73,495,666 V477A probably damaging Het
Gcdh A G 8: 84,892,857 L103P probably damaging Het
Gm27013 G A 6: 130,675,979 T840I probably damaging Het
Gpr179 A T 11: 97,338,330 W1000R probably damaging Het
Hectd4 C T 5: 121,281,101 A581V unknown Het
Ints12 T A 3: 133,109,160 V376E probably damaging Het
Krt77 T C 15: 101,861,230 I402V probably benign Het
March1 T C 8: 66,418,890 V102A probably damaging Het
Meis1 A T 11: 19,016,168 N68K probably benign Het
Mthfd1l A G 10: 4,106,432 E916G probably benign Het
Muc5ac T C 7: 141,807,832 F1627L possibly damaging Het
Myef2 A T 2: 125,116,703 M102K probably benign Het
Naip6 A C 13: 100,298,915 H1033Q probably benign Het
Nid1 T A 13: 13,489,037 C760* probably null Het
Nt5dc1 A T 10: 34,397,230 C191S probably benign Het
Nup214 A G 2: 31,988,176 E285G possibly damaging Het
Nvl A G 1: 181,135,036 L123P probably damaging Het
Olfr1094 T A 2: 86,829,317 H188Q probably damaging Het
Otog A G 7: 46,261,699 E658G probably damaging Het
Pam16 G T 16: 4,618,016 probably benign Het
Rabgap1l A G 1: 160,351,328 S21P possibly damaging Het
Rgs22 T A 15: 36,099,652 M306L probably damaging Het
Ruvbl1 A G 6: 88,467,600 K59R probably benign Het
Samd9l T C 6: 3,373,898 E1121G possibly damaging Het
Serpinb13 A G 1: 106,998,602 N169S probably benign Het
Setbp1 T A 18: 79,086,712 T102S probably damaging Het
Syn3 A T 10: 86,080,226 S299T probably benign Het
Taar7a A G 10: 23,992,631 L284P probably damaging Het
Tlr6 C A 5: 64,953,406 Q719H probably damaging Het
Tmem131 T A 1: 36,889,280 D76V probably damaging Het
Tradd T G 8: 105,259,625 D145A possibly damaging Het
Usp20 A T 2: 31,010,226 M251L probably benign Het
Vmn2r96 T A 17: 18,597,829 L556Q probably damaging Het
Xrcc2 A G 5: 25,692,319 S211P probably benign Het
Other mutations in Psg17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Psg17 APN 7 18820166 missense probably damaging 1.00
IGL01649:Psg17 APN 7 18816802 missense possibly damaging 0.60
IGL02171:Psg17 APN 7 18818787 missense probably damaging 0.98
PIT4151001:Psg17 UTSW 7 18814605 missense probably benign 0.26
R1178:Psg17 UTSW 7 18814455 missense probably benign 0.13
R1767:Psg17 UTSW 7 18816802 missense possibly damaging 0.60
R1991:Psg17 UTSW 7 18814652 missense probably benign 0.02
R4428:Psg17 UTSW 7 18816792 missense probably benign 0.31
R5285:Psg17 UTSW 7 18820201 missense probably benign 0.01
R5516:Psg17 UTSW 7 18814533 missense probably benign 0.30
R5837:Psg17 UTSW 7 18820215 missense possibly damaging 0.58
R6481:Psg17 UTSW 7 18814450 missense probably damaging 1.00
R6817:Psg17 UTSW 7 18814640 missense probably damaging 1.00
R7124:Psg17 UTSW 7 18814496 missense probably damaging 1.00
R7124:Psg17 UTSW 7 18814497 missense probably damaging 1.00
R7243:Psg17 UTSW 7 18818715 missense probably damaging 1.00
R7268:Psg17 UTSW 7 18814661 missense possibly damaging 0.64
R7384:Psg17 UTSW 7 18818660 missense possibly damaging 0.67
Z1088:Psg17 UTSW 7 18816910 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATTGTTCTCCACCGTGTGTG -3'
(R):5'- GCGTTGATAATCTGCCAGAGAATC -3'

Sequencing Primer
(F):5'- CACCGTGTGTGTCCTGC -3'
(R):5'- AATCTGCCAGAGAATCTTCTAGG -3'
Posted On2016-10-05