Incidental Mutation 'R5507:Chga'
ID431001
Institutional Source Beutler Lab
Gene Symbol Chga
Ensembl Gene ENSMUSG00000021194
Gene Namechromogranin A
SynonymsChrA
MMRRC Submission 043068-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5507 (G1)
Quality Score174
Status Validated
Chromosome12
Chromosomal Location102554969-102565028 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102562609 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 282 (S282P)
Ref Sequence ENSEMBL: ENSMUSP00000021610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021610]
Predicted Effect probably benign
Transcript: ENSMUST00000021610
AA Change: S282P

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021610
Gene: ENSMUSG00000021194
AA Change: S282P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Granin 25 95 3e-26 PFAM
Pfam:Granin 87 463 1.7e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223100
Meta Mutation Damage Score 0.1408 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.2%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene encodes a member of the granin family of acidic secretory glycoproteins that are expressed in endocrine cells and neurons. The encoded preproprotein undergoes proteolytic processing to generate multiple functions peptides including pancreastatin, catestatin and serpinin. The encoded protein plays important roles in the neuroendocrine system including regulated secretion of peptide hormones and neurotransmitters. Mice lacking the encoded protein exhibit elevated blood pressure which can be rescued by transgenic expression of the human ortholog. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes and heterozygotes for one allele display hypertension, abnormal plasma and adrenal adrenaline and noradrenaline levels and, in homozygotes, partial embryonic lethality. Homozygotes for a second allele only have elevated urinary adrenaline, noradrenaline and dopamine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A G 4: 39,451,084 T97A probably damaging Het
1700017N19Rik T C 10: 100,609,233 S27P probably benign Het
Acoxl C A 2: 127,884,474 A256E probably damaging Het
Akap9 A G 5: 3,968,683 E1088G probably benign Het
Alox12 T C 11: 70,254,412 T112A possibly damaging Het
Ampd2 A G 3: 108,077,613 V379A probably damaging Het
Ap4e1 C A 2: 127,008,898 H49N probably damaging Het
Arhgap11a T C 2: 113,841,678 T260A probably benign Het
Atg2a T C 19: 6,245,070 F171S possibly damaging Het
Bpifb9b A T 2: 154,317,027 Y488F possibly damaging Het
C2cd2 T C 16: 97,881,620 T139A probably benign Het
Cct8l1 A T 5: 25,516,379 T31S probably benign Het
Cdhr1 A T 14: 37,082,845 N469K probably damaging Het
Chrnb4 T G 9: 55,035,012 H326P probably damaging Het
Cntnap1 A G 11: 101,183,477 T748A probably benign Het
Cpsf3 T A 12: 21,297,928 L250H probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dppa5a T A 9: 78,368,071 D10V possibly damaging Het
Dsc2 G A 18: 20,046,279 T244I probably damaging Het
Elavl4 T C 4: 110,213,206 T144A probably benign Het
Ephb1 C T 9: 101,936,116 V776M probably damaging Het
Fcrl1 C T 3: 87,391,242 S348F probably benign Het
Fga T A 3: 83,033,336 W766R probably damaging Het
Galnt14 A G 17: 73,495,666 V477A probably damaging Het
Gcdh A G 8: 84,892,857 L103P probably damaging Het
Gm27013 G A 6: 130,675,979 T840I probably damaging Het
Gpr179 A T 11: 97,338,330 W1000R probably damaging Het
Hectd4 C T 5: 121,281,101 A581V unknown Het
Ints12 T A 3: 133,109,160 V376E probably damaging Het
Krt77 T C 15: 101,861,230 I402V probably benign Het
March1 T C 8: 66,418,890 V102A probably damaging Het
Meis1 A T 11: 19,016,168 N68K probably benign Het
Mthfd1l A G 10: 4,106,432 E916G probably benign Het
Muc5ac T C 7: 141,807,832 F1627L possibly damaging Het
Myef2 A T 2: 125,116,703 M102K probably benign Het
Naip6 A C 13: 100,298,915 H1033Q probably benign Het
Nid1 T A 13: 13,489,037 C760* probably null Het
Nt5dc1 A T 10: 34,397,230 C191S probably benign Het
Nup214 A G 2: 31,988,176 E285G possibly damaging Het
Nvl A G 1: 181,135,036 L123P probably damaging Het
Olfr1094 T A 2: 86,829,317 H188Q probably damaging Het
Otog A G 7: 46,261,699 E658G probably damaging Het
Pam16 G T 16: 4,618,016 probably benign Het
Psg17 T C 7: 18,819,926 D133G probably benign Het
Rabgap1l A G 1: 160,351,328 S21P possibly damaging Het
Rgs22 T A 15: 36,099,652 M306L probably damaging Het
Ruvbl1 A G 6: 88,467,600 K59R probably benign Het
Samd9l T C 6: 3,373,898 E1121G possibly damaging Het
Serpinb13 A G 1: 106,998,602 N169S probably benign Het
Setbp1 T A 18: 79,086,712 T102S probably damaging Het
Syn3 A T 10: 86,080,226 S299T probably benign Het
Taar7a A G 10: 23,992,631 L284P probably damaging Het
Tlr6 C A 5: 64,953,406 Q719H probably damaging Het
Tmem131 T A 1: 36,889,280 D76V probably damaging Het
Tradd T G 8: 105,259,625 D145A possibly damaging Het
Usp20 A T 2: 31,010,226 M251L probably benign Het
Vmn2r96 T A 17: 18,597,829 L556Q probably damaging Het
Xrcc2 A G 5: 25,692,319 S211P probably benign Het
Other mutations in Chga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Chga APN 12 102562799 missense probably damaging 0.98
IGL02674:Chga APN 12 102562901 missense probably damaging 1.00
FR4589:Chga UTSW 12 102561402 small insertion probably benign
R0018:Chga UTSW 12 102558505 missense probably damaging 0.97
R0463:Chga UTSW 12 102562951 nonsense probably null
R1164:Chga UTSW 12 102563045 missense probably damaging 1.00
R1603:Chga UTSW 12 102564607 splice site probably null
R1727:Chga UTSW 12 102561437 missense possibly damaging 0.85
R1778:Chga UTSW 12 102561700 missense probably benign
R1800:Chga UTSW 12 102555905 missense probably damaging 0.99
R2071:Chga UTSW 12 102562863 missense probably damaging 1.00
R3415:Chga UTSW 12 102562784 missense probably benign 0.00
R3696:Chga UTSW 12 102561465 missense probably damaging 0.98
R5022:Chga UTSW 12 102562837 missense probably damaging 1.00
R5959:Chga UTSW 12 102561855 missense probably benign
R7338:Chga UTSW 12 102562841 missense probably damaging 1.00
R7410:Chga UTSW 12 102562607 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTCCTTTGAGGTTTGCAG -3'
(R):5'- CCAGGATCTCTGAAGCCATAGG -3'

Sequencing Primer
(F):5'- GCAGGGTCTTGCTTCATGCTC -3'
(R):5'- AGCTTCATGGAGCGGTCAG -3'
Posted On2016-10-05