Incidental Mutation 'R5508:Lct'
ID 431017
Institutional Source Beutler Lab
Gene Symbol Lct
Ensembl Gene ENSMUSG00000026354
Gene Name lactase
Synonyms LPH, LOC226413, Lphl
MMRRC Submission 043069-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5508 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 128212493-128256055 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 128221868 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 1557 (A1557V)
Ref Sequence ENSEMBL: ENSMUSP00000073190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073490]
AlphaFold F8VPT3
Predicted Effect probably damaging
Transcript: ENSMUST00000073490
AA Change: A1557V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073190
Gene: ENSMUSG00000026354
AA Change: A1557V

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 76 226 1.6e-19 PFAM
low complexity region 322 340 N/A INTRINSIC
Pfam:Glyco_hydro_1 380 849 4.8e-169 PFAM
low complexity region 865 875 N/A INTRINSIC
Pfam:Glyco_hydro_1 902 1368 3.7e-181 PFAM
Pfam:Glyco_hydro_1 1377 1844 6.9e-183 PFAM
transmembrane domain 1885 1907 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162067
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.7%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyl hydrolase 1 family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme is integral to the plasma membrane and has both phlorizin hydrolase activity and lactase activity. Mutations in this gene are associated with congenital lactase deficiency. Polymorphisms in this gene are associated with lactase persistence, in which intestinal lactase activity persists at childhood levels into adulthood. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Apc A G 18: 34,431,633 (GRCm39) D344G probably damaging Het
Asphd2 A T 5: 112,534,649 (GRCm39) F300I probably damaging Het
BC016579 T A 16: 45,453,369 (GRCm39) T149S possibly damaging Het
Bcl6b A T 11: 70,116,919 (GRCm39) H453Q probably damaging Het
Ccdc192 G A 18: 57,671,156 (GRCm39) probably null Het
Clec4b2 A G 6: 123,150,001 (GRCm39) probably benign Het
Crispld1 G T 1: 17,823,207 (GRCm39) C396F probably damaging Het
Dnase1l3 A G 14: 7,968,146 (GRCm38) V253A probably damaging Het
Efhd1 A G 1: 87,237,516 (GRCm39) *241W probably null Het
Flvcr1 C T 1: 190,757,656 (GRCm39) G212D probably damaging Het
Golga2 T A 2: 32,178,199 (GRCm39) L36* probably null Het
Gprc5c G T 11: 114,755,093 (GRCm39) V257L possibly damaging Het
Gtf3c2 G T 5: 31,331,805 (GRCm39) C4* probably null Het
Kit G T 5: 75,810,208 (GRCm39) C786F probably damaging Het
Klf14 T C 6: 30,934,977 (GRCm39) H219R probably damaging Het
Large2 A G 2: 92,200,248 (GRCm39) V122A possibly damaging Het
Lrp6 T G 6: 134,441,479 (GRCm39) K1162N probably benign Het
Mtmr11 G A 3: 96,071,084 (GRCm39) R147Q probably damaging Het
Pbld2 T A 10: 62,902,444 (GRCm39) probably null Het
Pcdhb3 A T 18: 37,434,179 (GRCm39) L48F probably damaging Het
Pdcd2 C T 17: 15,742,001 (GRCm39) D310N probably damaging Het
Phlpp1 G T 1: 106,292,120 (GRCm39) R993L probably benign Het
Prr36 G A 8: 4,266,488 (GRCm39) P21S probably damaging Het
Ptprq C A 10: 107,522,092 (GRCm39) V620L probably benign Het
Ranbp2 T A 10: 58,315,827 (GRCm39) D2182E probably damaging Het
Sass6 G A 3: 116,413,752 (GRCm39) R485K probably benign Het
Scoc A T 8: 84,162,571 (GRCm39) S68T probably damaging Het
Speer3 T A 5: 13,844,678 (GRCm39) L114I probably damaging Het
Ss18l1 C G 2: 179,699,446 (GRCm39) Q215E probably damaging Het
Stab2 T C 10: 86,796,143 (GRCm39) N368S probably benign Het
Trim80 T A 11: 115,335,904 (GRCm39) S275R probably benign Het
Tubb5 T C 17: 36,145,962 (GRCm39) N416S probably benign Het
Ugt2a3 A T 5: 87,475,059 (GRCm39) M395K probably damaging Het
Vmn2r61 T A 7: 41,916,242 (GRCm39) M285K possibly damaging Het
Xpo1 A G 11: 23,244,645 (GRCm39) I1008V probably benign Het
Other mutations in Lct
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Lct APN 1 128,215,293 (GRCm39) missense probably benign 0.09
IGL00970:Lct APN 1 128,231,805 (GRCm39) missense probably damaging 1.00
IGL01022:Lct APN 1 128,228,596 (GRCm39) missense probably benign
IGL01878:Lct APN 1 128,222,003 (GRCm39) missense probably damaging 1.00
IGL01892:Lct APN 1 128,235,342 (GRCm39) missense probably damaging 1.00
IGL02307:Lct APN 1 128,214,327 (GRCm39) missense possibly damaging 0.70
IGL02434:Lct APN 1 128,231,527 (GRCm39) missense probably damaging 0.97
IGL02559:Lct APN 1 128,222,003 (GRCm39) missense probably damaging 1.00
IGL02623:Lct APN 1 128,235,988 (GRCm39) missense probably benign 0.01
IGL02818:Lct APN 1 128,227,905 (GRCm39) missense probably damaging 1.00
IGL02949:Lct APN 1 128,240,869 (GRCm39) missense probably benign 0.26
IGL02951:Lct APN 1 128,227,948 (GRCm39) missense probably damaging 1.00
IGL03087:Lct APN 1 128,228,112 (GRCm39) missense possibly damaging 0.81
IGL03227:Lct APN 1 128,255,426 (GRCm39) missense probably benign 0.09
ANU18:Lct UTSW 1 128,235,784 (GRCm39) nonsense probably null
R0071:Lct UTSW 1 128,219,755 (GRCm39) nonsense probably null
R0071:Lct UTSW 1 128,219,755 (GRCm39) nonsense probably null
R0135:Lct UTSW 1 128,212,860 (GRCm39) missense probably damaging 0.98
R0145:Lct UTSW 1 128,255,632 (GRCm39) missense probably benign 0.00
R0179:Lct UTSW 1 128,255,422 (GRCm39) missense probably benign
R0331:Lct UTSW 1 128,226,479 (GRCm39) splice site probably benign
R0366:Lct UTSW 1 128,214,199 (GRCm39) missense probably benign 0.03
R0399:Lct UTSW 1 128,228,262 (GRCm39) missense probably damaging 1.00
R0492:Lct UTSW 1 128,228,319 (GRCm39) missense probably damaging 1.00
R0548:Lct UTSW 1 128,212,932 (GRCm39) missense probably damaging 1.00
R0691:Lct UTSW 1 128,235,971 (GRCm39) missense probably benign 0.00
R0755:Lct UTSW 1 128,221,872 (GRCm39) missense possibly damaging 0.46
R0839:Lct UTSW 1 128,214,346 (GRCm39) missense probably benign 0.00
R1128:Lct UTSW 1 128,229,046 (GRCm39) missense probably damaging 0.99
R1135:Lct UTSW 1 128,221,861 (GRCm39) critical splice donor site probably null
R1321:Lct UTSW 1 128,227,759 (GRCm39) missense probably benign
R1448:Lct UTSW 1 128,235,559 (GRCm39) missense probably damaging 0.99
R1450:Lct UTSW 1 128,235,640 (GRCm39) missense probably damaging 1.00
R1572:Lct UTSW 1 128,221,932 (GRCm39) missense probably benign 0.25
R1582:Lct UTSW 1 128,228,299 (GRCm39) missense probably damaging 1.00
R1668:Lct UTSW 1 128,215,459 (GRCm39) splice site probably null
R1757:Lct UTSW 1 128,228,994 (GRCm39) missense probably damaging 1.00
R1775:Lct UTSW 1 128,228,038 (GRCm39) missense probably damaging 1.00
R1792:Lct UTSW 1 128,255,679 (GRCm39) missense possibly damaging 0.54
R1815:Lct UTSW 1 128,227,896 (GRCm39) missense probably damaging 1.00
R1932:Lct UTSW 1 128,221,898 (GRCm39) missense probably damaging 1.00
R2325:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R2381:Lct UTSW 1 128,231,858 (GRCm39) nonsense probably null
R3001:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R3002:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R3003:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R3011:Lct UTSW 1 128,229,109 (GRCm39) missense possibly damaging 0.74
R3082:Lct UTSW 1 128,215,345 (GRCm39) missense probably damaging 1.00
R3683:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R3684:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R3726:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R3886:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R3887:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R3888:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R4019:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R4027:Lct UTSW 1 128,212,918 (GRCm39) missense probably benign 0.00
R4226:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R4409:Lct UTSW 1 128,231,963 (GRCm39) missense probably damaging 1.00
R4514:Lct UTSW 1 128,228,251 (GRCm39) missense probably benign
R4570:Lct UTSW 1 128,227,641 (GRCm39) missense probably benign 0.01
R4776:Lct UTSW 1 128,228,124 (GRCm39) missense probably damaging 0.99
R5001:Lct UTSW 1 128,235,978 (GRCm39) missense probably damaging 0.96
R5021:Lct UTSW 1 128,228,302 (GRCm39) missense probably benign 0.38
R5318:Lct UTSW 1 128,232,109 (GRCm39) missense probably damaging 1.00
R5330:Lct UTSW 1 128,226,266 (GRCm39) missense probably benign 0.06
R5385:Lct UTSW 1 128,239,354 (GRCm39) missense possibly damaging 0.63
R5499:Lct UTSW 1 128,214,414 (GRCm39) missense probably damaging 1.00
R5642:Lct UTSW 1 128,222,969 (GRCm39) missense probably damaging 1.00
R5724:Lct UTSW 1 128,228,073 (GRCm39) missense probably benign
R6026:Lct UTSW 1 128,227,755 (GRCm39) missense probably benign
R6044:Lct UTSW 1 128,235,717 (GRCm39) missense possibly damaging 0.95
R6175:Lct UTSW 1 128,255,451 (GRCm39) missense probably damaging 1.00
R6277:Lct UTSW 1 128,231,974 (GRCm39) missense probably benign 0.01
R6412:Lct UTSW 1 128,255,455 (GRCm39) missense probably benign 0.00
R6480:Lct UTSW 1 128,222,057 (GRCm39) missense probably damaging 1.00
R6526:Lct UTSW 1 128,228,215 (GRCm39) missense probably benign 0.05
R6620:Lct UTSW 1 128,222,809 (GRCm39) critical splice donor site probably null
R7214:Lct UTSW 1 128,228,197 (GRCm39) missense probably benign 0.00
R7308:Lct UTSW 1 128,246,824 (GRCm39) missense probably benign 0.00
R7577:Lct UTSW 1 128,228,469 (GRCm39) missense probably damaging 0.99
R7626:Lct UTSW 1 128,212,932 (GRCm39) missense probably damaging 1.00
R7737:Lct UTSW 1 128,226,430 (GRCm39) missense probably benign 0.12
R7901:Lct UTSW 1 128,216,722 (GRCm39) missense probably benign 0.44
R8033:Lct UTSW 1 128,212,996 (GRCm39) missense probably benign 0.03
R8373:Lct UTSW 1 128,231,577 (GRCm39) missense probably damaging 1.00
R8504:Lct UTSW 1 128,215,306 (GRCm39) missense probably damaging 1.00
R8751:Lct UTSW 1 128,221,534 (GRCm39) missense probably benign 0.18
R8781:Lct UTSW 1 128,215,261 (GRCm39) missense probably damaging 1.00
R8797:Lct UTSW 1 128,231,684 (GRCm39) missense possibly damaging 0.77
R8926:Lct UTSW 1 128,228,148 (GRCm39) missense probably damaging 1.00
R8949:Lct UTSW 1 128,221,929 (GRCm39) missense probably damaging 1.00
R8992:Lct UTSW 1 128,228,299 (GRCm39) missense probably damaging 1.00
R9138:Lct UTSW 1 128,227,894 (GRCm39) missense probably benign 0.03
R9260:Lct UTSW 1 128,227,704 (GRCm39) nonsense probably null
R9416:Lct UTSW 1 128,228,329 (GRCm39) missense possibly damaging 0.74
R9531:Lct UTSW 1 128,235,598 (GRCm39) missense probably benign 0.00
X0052:Lct UTSW 1 128,235,367 (GRCm39) missense probably damaging 1.00
YA93:Lct UTSW 1 128,229,057 (GRCm39) missense probably damaging 1.00
Z1176:Lct UTSW 1 128,215,348 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCCCTACTGAATGGTGGAG -3'
(R):5'- CATGTATCACTGGGACCTGC -3'

Sequencing Primer
(F):5'- CCCTACTGAATGGTGGAGAGTAGTC -3'
(R):5'- CTATGCCGATGTGCTCTT -3'
Posted On 2016-10-05