Incidental Mutation 'R5508:Ss18l1'
ID431023
Institutional Source Beutler Lab
Gene Symbol Ss18l1
Ensembl Gene ENSMUSG00000039086
Gene NameSS18, nBAF chromatin remodeling complex subunit like 1
SynonymsCREST, A230053O16Rik
MMRRC Submission 043069-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R5508 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location180042509-180070201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 180057653 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Glutamic Acid at position 215 (Q215E)
Ref Sequence ENSEMBL: ENSMUSP00000041288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041126]
Predicted Effect probably damaging
Transcript: ENSMUST00000041126
AA Change: Q215E

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041288
Gene: ENSMUSG00000039086
AA Change: Q215E

DomainStartEndE-ValueType
Pfam:SSXT 13 74 4.3e-35 PFAM
low complexity region 85 106 N/A INTRINSIC
low complexity region 215 238 N/A INTRINSIC
low complexity region 244 251 N/A INTRINSIC
low complexity region 311 375 N/A INTRINSIC
low complexity region 390 402 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.7%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium-responsive transactivator which is an essential subunit of a neuron-specific chromatin-remodeling complex. The structure of this gene is similar to that of the SS18 gene. Mutations in this gene are involved in amyotrophic lateral sclerosis (ALS). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have central nervous system and coordination defects. They grow slowly and usually die before adulthood. Those that do survive are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Apc A G 18: 34,298,580 D344G probably damaging Het
Asphd2 A T 5: 112,386,783 F300I probably damaging Het
BC016579 T A 16: 45,633,006 T149S possibly damaging Het
Bcl6b A T 11: 70,226,093 H453Q probably damaging Het
Clec4b2 A G 6: 123,173,042 probably benign Het
Crispld1 G T 1: 17,752,983 C396F probably damaging Het
Dnase1l3 A G 14: 7,968,146 V253A probably damaging Het
Efhd1 A G 1: 87,309,794 *241W probably null Het
Flvcr1 C T 1: 191,025,459 G212D probably damaging Het
Golga2 T A 2: 32,288,187 L36* probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf3c2 G T 5: 31,174,461 C4* probably null Het
Kit G T 5: 75,649,548 C786F probably damaging Het
Klf14 T C 6: 30,958,042 H219R probably damaging Het
Large2 A G 2: 92,369,903 V122A possibly damaging Het
Lct G A 1: 128,294,131 A1557V probably damaging Het
Lrp6 T G 6: 134,464,516 K1162N probably benign Het
Mtmr11 G A 3: 96,163,767 R147Q probably damaging Het
Pbld2 T A 10: 63,066,665 probably null Het
Pcdhb3 A T 18: 37,301,126 L48F probably damaging Het
Pdcd2 C T 17: 15,521,739 D310N probably damaging Het
Phlpp1 G T 1: 106,364,390 R993L probably benign Het
Prr36 G A 8: 4,216,488 P21S probably damaging Het
Ptprq C A 10: 107,686,231 V620L probably benign Het
Ranbp2 T A 10: 58,480,005 D2182E probably damaging Het
Sass6 G A 3: 116,620,103 R485K probably benign Het
Scoc A T 8: 83,435,942 S68T probably damaging Het
Speer3 T A 5: 13,794,664 L114I probably damaging Het
Stab2 T C 10: 86,960,279 N368S probably benign Het
Trim80 T A 11: 115,445,078 S275R probably benign Het
Tubb5 T C 17: 35,835,070 N416S probably benign Het
Ugt2a3 A T 5: 87,327,200 M395K probably damaging Het
Vmn2r61 T A 7: 42,266,818 M285K possibly damaging Het
Xpo1 A G 11: 23,294,645 I1008V probably benign Het
Other mutations in Ss18l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0781:Ss18l1 UTSW 2 180055854 missense possibly damaging 0.57
R0904:Ss18l1 UTSW 2 180059354 missense probably damaging 1.00
R1938:Ss18l1 UTSW 2 180063345 missense unknown
R2853:Ss18l1 UTSW 2 180058121 missense probably damaging 1.00
R3825:Ss18l1 UTSW 2 180063310 missense unknown
R4907:Ss18l1 UTSW 2 180063399 critical splice donor site probably null
R5256:Ss18l1 UTSW 2 180061942 missense unknown
R6216:Ss18l1 UTSW 2 180061913 missense unknown
R6218:Ss18l1 UTSW 2 180055112 missense probably benign 0.00
R7529:Ss18l1 UTSW 2 180058157 missense not run
Predicted Primers PCR Primer
(F):5'- ACCAGGTTTATGGATGCAGC -3'
(R):5'- TGCTTGTGCCTTGGAGAAAACC -3'

Sequencing Primer
(F):5'- TATGGATGCAGCTCACACTG -3'
(R):5'- CTTGTGCCTTGGAGAAAACCTTACG -3'
Posted On2016-10-05