Incidental Mutation 'R5508:Sass6'
ID431025
Institutional Source Beutler Lab
Gene Symbol Sass6
Ensembl Gene ENSMUSG00000027959
Gene NameSAS-6 centriolar assembly protein
Synonyms2810453L12Rik
MMRRC Submission 043069-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R5508 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location116594982-116631004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 116620103 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 485 (R485K)
Ref Sequence ENSEMBL: ENSMUSP00000143175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029571] [ENSMUST00000197335] [ENSMUST00000198311] [ENSMUST00000198386]
Predicted Effect probably benign
Transcript: ENSMUST00000029571
SMART Domains Protein: ENSMUSP00000029571
Gene: ENSMUSG00000027959

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:SAS-6_N 44 141 1.7e-29 PFAM
low complexity region 223 235 N/A INTRINSIC
coiled coil region 415 471 N/A INTRINSIC
low complexity region 632 644 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197063
Predicted Effect probably benign
Transcript: ENSMUST00000197335
AA Change: R450K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143123
Gene: ENSMUSG00000027959
AA Change: R450K

DomainStartEndE-ValueType
PDB:2Y3W|C 7 136 3e-48 PDB
low complexity region 188 200 N/A INTRINSIC
coiled coil region 380 436 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198311
AA Change: R485K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143233
Gene: ENSMUSG00000027959
AA Change: R485K

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
PDB:2Y3W|C 15 171 9e-62 PDB
low complexity region 223 235 N/A INTRINSIC
coiled coil region 415 471 N/A INTRINSIC
low complexity region 632 644 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198386
AA Change: R485K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143175
Gene: ENSMUSG00000027959
AA Change: R485K

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
PDB:2Y3W|C 15 171 1e-62 PDB
low complexity region 223 235 N/A INTRINSIC
coiled coil region 415 471 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.7%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a central component of centrioles and is necessary for their duplication and function. Centrioles adopt a cartwheel-shaped structure, with the encoded protein forming the hub and spokes inside a microtubule cylinder. Defects in this gene are a cause of autosomal recessive primary microcephaly. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Apc A G 18: 34,298,580 D344G probably damaging Het
Asphd2 A T 5: 112,386,783 F300I probably damaging Het
BC016579 T A 16: 45,633,006 T149S possibly damaging Het
Bcl6b A T 11: 70,226,093 H453Q probably damaging Het
Clec4b2 A G 6: 123,173,042 probably benign Het
Crispld1 G T 1: 17,752,983 C396F probably damaging Het
Dnase1l3 A G 14: 7,968,146 V253A probably damaging Het
Efhd1 A G 1: 87,309,794 *241W probably null Het
Flvcr1 C T 1: 191,025,459 G212D probably damaging Het
Golga2 T A 2: 32,288,187 L36* probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf3c2 G T 5: 31,174,461 C4* probably null Het
Kit G T 5: 75,649,548 C786F probably damaging Het
Klf14 T C 6: 30,958,042 H219R probably damaging Het
Large2 A G 2: 92,369,903 V122A possibly damaging Het
Lct G A 1: 128,294,131 A1557V probably damaging Het
Lrp6 T G 6: 134,464,516 K1162N probably benign Het
Mtmr11 G A 3: 96,163,767 R147Q probably damaging Het
Pbld2 T A 10: 63,066,665 probably null Het
Pcdhb3 A T 18: 37,301,126 L48F probably damaging Het
Pdcd2 C T 17: 15,521,739 D310N probably damaging Het
Phlpp1 G T 1: 106,364,390 R993L probably benign Het
Prr36 G A 8: 4,216,488 P21S probably damaging Het
Ptprq C A 10: 107,686,231 V620L probably benign Het
Ranbp2 T A 10: 58,480,005 D2182E probably damaging Het
Scoc A T 8: 83,435,942 S68T probably damaging Het
Speer3 T A 5: 13,794,664 L114I probably damaging Het
Ss18l1 C G 2: 180,057,653 Q215E probably damaging Het
Stab2 T C 10: 86,960,279 N368S probably benign Het
Trim80 T A 11: 115,445,078 S275R probably benign Het
Tubb5 T C 17: 35,835,070 N416S probably benign Het
Ugt2a3 A T 5: 87,327,200 M395K probably damaging Het
Vmn2r61 T A 7: 42,266,818 M285K possibly damaging Het
Xpo1 A G 11: 23,294,645 I1008V probably benign Het
Other mutations in Sass6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00732:Sass6 APN 3 116618328 missense probably damaging 1.00
IGL00755:Sass6 APN 3 116618328 missense probably damaging 1.00
IGL01067:Sass6 APN 3 116613956 missense possibly damaging 0.90
IGL01563:Sass6 APN 3 116605198 missense probably damaging 1.00
R0388:Sass6 UTSW 3 116607308 splice site probably benign
R0918:Sass6 UTSW 3 116603523 critical splice donor site probably null
R1557:Sass6 UTSW 3 116618732 missense possibly damaging 0.62
R1681:Sass6 UTSW 3 116603473 missense possibly damaging 0.87
R1742:Sass6 UTSW 3 116607477 missense probably damaging 1.00
R1958:Sass6 UTSW 3 116610296 missense possibly damaging 0.84
R4839:Sass6 UTSW 3 116610300 missense probably damaging 0.99
R5087:Sass6 UTSW 3 116610298 missense probably damaging 1.00
R5225:Sass6 UTSW 3 116614053 missense possibly damaging 0.87
R5615:Sass6 UTSW 3 116607486 missense probably benign
R5642:Sass6 UTSW 3 116607496 critical splice donor site probably null
R6478:Sass6 UTSW 3 116621397 missense probably benign 0.01
R6781:Sass6 UTSW 3 116595124 unclassified probably benign
R7457:Sass6 UTSW 3 116620164 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GCAGCTATAGAAACTGAATGCTAC -3'
(R):5'- TAATCAAGCACGCGTAGGCC -3'

Sequencing Primer
(F):5'- GTGATCCGAACCTTTGAGCAACTG -3'
(R):5'- TAGGCCTAGGCTGCAGTCAAG -3'
Posted On2016-10-05