Incidental Mutation 'R5508:Speer3'
ID431026
Institutional Source Beutler Lab
Gene Symbol Speer3
Ensembl Gene ENSMUSG00000067855
Gene Namespermatogenesis associated glutamate (E)-rich protein 3
SynonymsSPEER-3, 4933405P08Rik
MMRRC Submission 043069-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5508 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location13791619-13796820 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13794664 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 114 (L114I)
Ref Sequence ENSEMBL: ENSMUSP00000115668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124677]
Predicted Effect probably damaging
Transcript: ENSMUST00000124677
AA Change: L114I

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115668
Gene: ENSMUSG00000067855
AA Change: L114I

DomainStartEndE-ValueType
Pfam:Takusan 48 134 2.3e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199961
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.7%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Apc A G 18: 34,298,580 D344G probably damaging Het
Asphd2 A T 5: 112,386,783 F300I probably damaging Het
BC016579 T A 16: 45,633,006 T149S possibly damaging Het
Bcl6b A T 11: 70,226,093 H453Q probably damaging Het
Clec4b2 A G 6: 123,173,042 probably benign Het
Crispld1 G T 1: 17,752,983 C396F probably damaging Het
Dnase1l3 A G 14: 7,968,146 V253A probably damaging Het
Efhd1 A G 1: 87,309,794 *241W probably null Het
Flvcr1 C T 1: 191,025,459 G212D probably damaging Het
Golga2 T A 2: 32,288,187 L36* probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf3c2 G T 5: 31,174,461 C4* probably null Het
Kit G T 5: 75,649,548 C786F probably damaging Het
Klf14 T C 6: 30,958,042 H219R probably damaging Het
Large2 A G 2: 92,369,903 V122A possibly damaging Het
Lct G A 1: 128,294,131 A1557V probably damaging Het
Lrp6 T G 6: 134,464,516 K1162N probably benign Het
Mtmr11 G A 3: 96,163,767 R147Q probably damaging Het
Pbld2 T A 10: 63,066,665 probably null Het
Pcdhb3 A T 18: 37,301,126 L48F probably damaging Het
Pdcd2 C T 17: 15,521,739 D310N probably damaging Het
Phlpp1 G T 1: 106,364,390 R993L probably benign Het
Prr36 G A 8: 4,216,488 P21S probably damaging Het
Ptprq C A 10: 107,686,231 V620L probably benign Het
Ranbp2 T A 10: 58,480,005 D2182E probably damaging Het
Sass6 G A 3: 116,620,103 R485K probably benign Het
Scoc A T 8: 83,435,942 S68T probably damaging Het
Ss18l1 C G 2: 180,057,653 Q215E probably damaging Het
Stab2 T C 10: 86,960,279 N368S probably benign Het
Trim80 T A 11: 115,445,078 S275R probably benign Het
Tubb5 T C 17: 35,835,070 N416S probably benign Het
Ugt2a3 A T 5: 87,327,200 M395K probably damaging Het
Vmn2r61 T A 7: 42,266,818 M285K possibly damaging Het
Xpo1 A G 11: 23,294,645 I1008V probably benign Het
Other mutations in Speer3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01663:Speer3 APN 5 13793222 nonsense probably null
IGL02730:Speer3 APN 5 13793271 missense probably benign
IGL03192:Speer3 APN 5 13791688 missense possibly damaging 0.93
IGL03301:Speer3 APN 5 13795433 missense probably damaging 1.00
R1623:Speer3 UTSW 5 13796321 missense probably benign
R3028:Speer3 UTSW 5 13795431 missense probably damaging 0.99
R4091:Speer3 UTSW 5 13796380 missense possibly damaging 0.70
R4092:Speer3 UTSW 5 13796380 missense possibly damaging 0.70
R4368:Speer3 UTSW 5 13796380 missense possibly damaging 0.70
R4369:Speer3 UTSW 5 13796380 missense possibly damaging 0.70
R4405:Speer3 UTSW 5 13796380 missense possibly damaging 0.70
R4450:Speer3 UTSW 5 13796380 missense possibly damaging 0.70
R4509:Speer3 UTSW 5 13796354 missense possibly damaging 0.72
R4594:Speer3 UTSW 5 13796380 missense possibly damaging 0.70
R4702:Speer3 UTSW 5 13796380 missense possibly damaging 0.70
R5096:Speer3 UTSW 5 13796380 missense possibly damaging 0.70
R5583:Speer3 UTSW 5 13794768 critical splice donor site probably null
R6061:Speer3 UTSW 5 13794691 missense possibly damaging 0.88
R6337:Speer3 UTSW 5 13793355 missense probably damaging 0.96
R6518:Speer3 UTSW 5 13795448 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TCAAAGCTGAAGATCATCCCAG -3'
(R):5'- TATCCCAAGGCACACTGATGG -3'

Sequencing Primer
(F):5'- CCCAGTATATAGAATCCAGAATGTGC -3'
(R):5'- GCACACTGATGGCTAAAAGC -3'
Posted On2016-10-05