Incidental Mutation 'R5508:Gtf3c2'
ID431027
Institutional Source Beutler Lab
Gene Symbol Gtf3c2
Ensembl Gene ENSMUSG00000106864
Gene Namegeneral transcription factor IIIC, polypeptide 2, beta
SynonymsTFIIIC110, 2610510G03Rik, TFIIIC-BETA, 1300004C11Rik
MMRRC Submission 043069-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.539) question?
Stock #R5508 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location31156005-31180144 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 31174461 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 4 (C4*)
Ref Sequence ENSEMBL: ENSMUSP00000144489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088010] [ENSMUST00000101411] [ENSMUST00000200871] [ENSMUST00000201428] [ENSMUST00000201468] [ENSMUST00000202300] [ENSMUST00000202639]
Predicted Effect probably null
Transcript: ENSMUST00000043161
AA Change: C4*
SMART Domains Protein: ENSMUSP00000047210
Gene: ENSMUSG00000029144
AA Change: C4*

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 232 243 N/A INTRINSIC
low complexity region 250 268 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
WD40 495 551 6.39e0 SMART
WD40 573 623 1.6e0 SMART
WD40 641 681 3.37e-6 SMART
WD40 864 904 5.33e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000088010
AA Change: C4*
SMART Domains Protein: ENSMUSP00000085325
Gene: ENSMUSG00000106864
AA Change: C4*

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 207 225 N/A INTRINSIC
low complexity region 249 268 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
WD40 452 508 6.39e0 SMART
WD40 530 580 1.6e0 SMART
WD40 598 638 3.37e-6 SMART
WD40 821 861 5.33e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000101411
AA Change: C4*
SMART Domains Protein: ENSMUSP00000098957
Gene: ENSMUSG00000101678
AA Change: C4*

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 207 225 N/A INTRINSIC
low complexity region 249 268 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
WD40 452 508 6.39e0 SMART
WD40 530 580 1.6e0 SMART
WD40 598 638 3.37e-6 SMART
Blast:WD40 807 844 2e-8 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000135900
AA Change: C21*
Predicted Effect probably null
Transcript: ENSMUST00000140793
AA Change: C4*
SMART Domains Protein: ENSMUSP00000119247
Gene: ENSMUSG00000029144
AA Change: C4*

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151370
AA Change: A95E
Predicted Effect probably null
Transcript: ENSMUST00000153504
AA Change: C4*
SMART Domains Protein: ENSMUSP00000120538
Gene: ENSMUSG00000029144
AA Change: C4*

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000200871
AA Change: C4*
Predicted Effect probably null
Transcript: ENSMUST00000201428
AA Change: C4*
SMART Domains Protein: ENSMUSP00000144212
Gene: ENSMUSG00000106864
AA Change: C4*

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000201468
AA Change: C4*
SMART Domains Protein: ENSMUSP00000144675
Gene: ENSMUSG00000106864
AA Change: C4*

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202254
Predicted Effect probably null
Transcript: ENSMUST00000202300
AA Change: C4*
SMART Domains Protein: ENSMUSP00000144249
Gene: ENSMUSG00000106864
AA Change: C4*

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202639
AA Change: C4*
SMART Domains Protein: ENSMUSP00000144489
Gene: ENSMUSG00000106864
AA Change: C4*

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 232 243 N/A INTRINSIC
low complexity region 250 268 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
WD40 495 551 6.39e0 SMART
WD40 573 623 1.6e0 SMART
WD40 641 681 3.37e-6 SMART
WD40 864 904 5.33e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202843
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.7%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Apc A G 18: 34,298,580 D344G probably damaging Het
Asphd2 A T 5: 112,386,783 F300I probably damaging Het
BC016579 T A 16: 45,633,006 T149S possibly damaging Het
Bcl6b A T 11: 70,226,093 H453Q probably damaging Het
Clec4b2 A G 6: 123,173,042 probably benign Het
Crispld1 G T 1: 17,752,983 C396F probably damaging Het
Dnase1l3 A G 14: 7,968,146 V253A probably damaging Het
Efhd1 A G 1: 87,309,794 *241W probably null Het
Flvcr1 C T 1: 191,025,459 G212D probably damaging Het
Golga2 T A 2: 32,288,187 L36* probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Kit G T 5: 75,649,548 C786F probably damaging Het
Klf14 T C 6: 30,958,042 H219R probably damaging Het
Large2 A G 2: 92,369,903 V122A possibly damaging Het
Lct G A 1: 128,294,131 A1557V probably damaging Het
Lrp6 T G 6: 134,464,516 K1162N probably benign Het
Mtmr11 G A 3: 96,163,767 R147Q probably damaging Het
Pbld2 T A 10: 63,066,665 probably null Het
Pcdhb3 A T 18: 37,301,126 L48F probably damaging Het
Pdcd2 C T 17: 15,521,739 D310N probably damaging Het
Phlpp1 G T 1: 106,364,390 R993L probably benign Het
Prr36 G A 8: 4,216,488 P21S probably damaging Het
Ptprq C A 10: 107,686,231 V620L probably benign Het
Ranbp2 T A 10: 58,480,005 D2182E probably damaging Het
Sass6 G A 3: 116,620,103 R485K probably benign Het
Scoc A T 8: 83,435,942 S68T probably damaging Het
Speer3 T A 5: 13,794,664 L114I probably damaging Het
Ss18l1 C G 2: 180,057,653 Q215E probably damaging Het
Stab2 T C 10: 86,960,279 N368S probably benign Het
Trim80 T A 11: 115,445,078 S275R probably benign Het
Tubb5 T C 17: 35,835,070 N416S probably benign Het
Ugt2a3 A T 5: 87,327,200 M395K probably damaging Het
Vmn2r61 T A 7: 42,266,818 M285K possibly damaging Het
Xpo1 A G 11: 23,294,645 I1008V probably benign Het
Other mutations in Gtf3c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Gtf3c2 APN 5 31174408 missense probably damaging 1.00
IGL00832:Gtf3c2 APN 5 31173005 unclassified probably benign
IGL00904:Gtf3c2 APN 5 31172858 missense probably damaging 1.00
IGL00966:Gtf3c2 APN 5 31170173 critical splice donor site probably benign 0.00
IGL01061:Gtf3c2 APN 5 31168354 missense possibly damaging 0.94
IGL01148:Gtf3c2 APN 5 31159824 missense probably damaging 1.00
IGL01767:Gtf3c2 APN 5 31157635 missense probably benign 0.08
IGL02237:Gtf3c2 APN 5 31159053 splice site probably benign
IGL02458:Gtf3c2 APN 5 31159523 critical splice acceptor site probably null
IGL02888:Gtf3c2 APN 5 31173825 missense probably damaging 1.00
IGL03035:Gtf3c2 APN 5 31166014 missense possibly damaging 0.96
IGL03131:Gtf3c2 APN 5 31157620 missense probably damaging 0.98
R0534:Gtf3c2 UTSW 5 31158132 splice site probably benign
R0581:Gtf3c2 UTSW 5 31159518 nonsense probably null
R0634:Gtf3c2 UTSW 5 31159806 nonsense probably null
R1172:Gtf3c2 UTSW 5 31168075 missense probably damaging 1.00
R1511:Gtf3c2 UTSW 5 31159102 missense probably benign 0.15
R1680:Gtf3c2 UTSW 5 31173868 missense probably damaging 1.00
R1726:Gtf3c2 UTSW 5 31169123 missense possibly damaging 0.82
R1831:Gtf3c2 UTSW 5 31168369 missense probably damaging 1.00
R2006:Gtf3c2 UTSW 5 31168096 missense probably damaging 0.99
R2437:Gtf3c2 UTSW 5 31159698 critical splice donor site probably null
R4732:Gtf3c2 UTSW 5 31160057 missense probably damaging 0.97
R4733:Gtf3c2 UTSW 5 31160057 missense probably damaging 0.97
R4787:Gtf3c2 UTSW 5 31157577 missense probably benign 0.03
R4817:Gtf3c2 UTSW 5 31174090 critical splice acceptor site probably null
R4863:Gtf3c2 UTSW 5 31159233 intron probably benign
R4926:Gtf3c2 UTSW 5 31169123 missense possibly damaging 0.82
R5704:Gtf3c2 UTSW 5 31159110 missense probably damaging 1.00
R5737:Gtf3c2 UTSW 5 31168249 critical splice donor site probably null
R5868:Gtf3c2 UTSW 5 31168081 missense possibly damaging 0.94
R6174:Gtf3c2 UTSW 5 31158211 missense probably damaging 1.00
R6705:Gtf3c2 UTSW 5 31166008 missense possibly damaging 0.93
R6782:Gtf3c2 UTSW 5 31169836 missense probably benign 0.01
R6893:Gtf3c2 UTSW 5 31166378 missense probably benign 0.06
R7363:Gtf3c2 UTSW 5 31170256 missense probably damaging 1.00
R7474:Gtf3c2 UTSW 5 31167756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCAAATCCAGGCAAAGGAG -3'
(R):5'- TGTCTTTTGAGGGGCCACAC -3'

Sequencing Primer
(F):5'- GGAGGTAGTGACATCTCGATG -3'
(R):5'- CTTACACATGCTACGTGGATCAGG -3'
Posted On2016-10-05