Incidental Mutation 'R5508:Lrp6'
ID431032
Institutional Source Beutler Lab
Gene Symbol Lrp6
Ensembl Gene ENSMUSG00000030201
Gene Namelow density lipoprotein receptor-related protein 6
Synonymsskax26, Cd, ska26, ska
MMRRC Submission 043069-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R5508 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location134446476-134566965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 134464516 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 1162 (K1162N)
Ref Sequence ENSEMBL: ENSMUSP00000032322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032322]
Predicted Effect probably benign
Transcript: ENSMUST00000032322
AA Change: K1162N

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032322
Gene: ENSMUSG00000030201
AA Change: K1162N

DomainStartEndE-ValueType
LY 43 85 1.55e-2 SMART
LY 87 129 1.91e-11 SMART
LY 130 173 5.19e-13 SMART
LY 174 216 1.39e-13 SMART
LY 217 258 2.87e-6 SMART
EGF 285 324 2.16e-1 SMART
low complexity region 330 341 N/A INTRINSIC
LY 352 394 1.29e-8 SMART
LY 395 437 5.73e-15 SMART
LY 438 481 1.07e-14 SMART
LY 482 524 3.07e-15 SMART
LY 525 565 4.66e-6 SMART
EGF 591 628 1.47e-3 SMART
LY 654 696 2.06e-7 SMART
LY 697 739 3.73e-14 SMART
LY 740 783 3.37e-12 SMART
LY 784 825 1.17e-6 SMART
LY 827 865 1.91e-2 SMART
EGF 892 930 7.35e-4 SMART
LY 957 999 1.41e-5 SMART
LY 1005 1048 5.32e-1 SMART
LY 1049 1093 5e-6 SMART
LY 1094 1136 4.25e-9 SMART
LY 1137 1177 1.91e-2 SMART
EGF 1206 1250 1.23e1 SMART
LDLa 1248 1287 2.42e-12 SMART
LDLa 1288 1324 4.37e-10 SMART
LDLa 1325 1362 1.66e-10 SMART
transmembrane domain 1371 1393 N/A INTRINSIC
low complexity region 1429 1438 N/A INTRINSIC
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1508 1524 N/A INTRINSIC
low complexity region 1566 1573 N/A INTRINSIC
low complexity region 1596 1608 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111950
SMART Domains Protein: ENSMUSP00000107581
Gene: ENSMUSG00000030201

DomainStartEndE-ValueType
LY 11 53 1.41e-5 SMART
LY 59 102 5.32e-1 SMART
LY 103 147 5e-6 SMART
LY 148 190 4.25e-9 SMART
LY 191 231 1.91e-2 SMART
EGF 260 304 1.23e1 SMART
LDLa 302 341 2.42e-12 SMART
LDLa 342 378 4.37e-10 SMART
LDLa 379 416 1.66e-10 SMART
transmembrane domain 425 447 N/A INTRINSIC
low complexity region 483 492 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
low complexity region 562 578 N/A INTRINSIC
low complexity region 620 627 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203773
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.7%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.[provided by RefSeq, Dec 2009]
PHENOTYPE: Animals homozygous for this mutation exhibit partial embryonic lethality, growth retardation, crooked tail, abnormal vertebrae, small skull with occasional bent nose, absence of the third molars and small and/or unerupted lower incisors. Heterozygotes exhibit a crooked tail and abnormal vertebrae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Apc A G 18: 34,298,580 D344G probably damaging Het
Asphd2 A T 5: 112,386,783 F300I probably damaging Het
BC016579 T A 16: 45,633,006 T149S possibly damaging Het
Bcl6b A T 11: 70,226,093 H453Q probably damaging Het
Clec4b2 A G 6: 123,173,042 probably benign Het
Crispld1 G T 1: 17,752,983 C396F probably damaging Het
Dnase1l3 A G 14: 7,968,146 V253A probably damaging Het
Efhd1 A G 1: 87,309,794 *241W probably null Het
Flvcr1 C T 1: 191,025,459 G212D probably damaging Het
Golga2 T A 2: 32,288,187 L36* probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf3c2 G T 5: 31,174,461 C4* probably null Het
Kit G T 5: 75,649,548 C786F probably damaging Het
Klf14 T C 6: 30,958,042 H219R probably damaging Het
Large2 A G 2: 92,369,903 V122A possibly damaging Het
Lct G A 1: 128,294,131 A1557V probably damaging Het
Mtmr11 G A 3: 96,163,767 R147Q probably damaging Het
Pbld2 T A 10: 63,066,665 probably null Het
Pcdhb3 A T 18: 37,301,126 L48F probably damaging Het
Pdcd2 C T 17: 15,521,739 D310N probably damaging Het
Phlpp1 G T 1: 106,364,390 R993L probably benign Het
Prr36 G A 8: 4,216,488 P21S probably damaging Het
Ptprq C A 10: 107,686,231 V620L probably benign Het
Ranbp2 T A 10: 58,480,005 D2182E probably damaging Het
Sass6 G A 3: 116,620,103 R485K probably benign Het
Scoc A T 8: 83,435,942 S68T probably damaging Het
Speer3 T A 5: 13,794,664 L114I probably damaging Het
Ss18l1 C G 2: 180,057,653 Q215E probably damaging Het
Stab2 T C 10: 86,960,279 N368S probably benign Het
Trim80 T A 11: 115,445,078 S275R probably benign Het
Tubb5 T C 17: 35,835,070 N416S probably benign Het
Ugt2a3 A T 5: 87,327,200 M395K probably damaging Het
Vmn2r61 T A 7: 42,266,818 M285K possibly damaging Het
Xpo1 A G 11: 23,294,645 I1008V probably benign Het
Other mutations in Lrp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Lrp6 APN 6 134456090 missense probably benign 0.17
IGL00765:Lrp6 APN 6 134541854 missense probably benign 0.02
IGL00898:Lrp6 APN 6 134479739 missense probably damaging 0.99
IGL00916:Lrp6 APN 6 134484289 missense probably damaging 1.00
IGL00961:Lrp6 APN 6 134507646 missense probably damaging 0.98
IGL01620:Lrp6 APN 6 134511262 missense probably damaging 1.00
IGL01765:Lrp6 APN 6 134456145 missense probably damaging 0.99
IGL02066:Lrp6 APN 6 134450937 nonsense probably null
IGL02067:Lrp6 APN 6 134480396 missense probably damaging 0.99
IGL02169:Lrp6 APN 6 134513327 missense probably damaging 0.96
IGL02281:Lrp6 APN 6 134457734 missense probably benign 0.40
IGL02484:Lrp6 APN 6 134541923 missense probably benign 0.15
IGL02724:Lrp6 APN 6 134484265 missense probably damaging 1.00
IGL02876:Lrp6 APN 6 134456114 missense probably benign 0.43
IGL03011:Lrp6 APN 6 134520417 missense possibly damaging 0.80
IGL03352:Lrp6 APN 6 134479763 missense probably damaging 1.00
Coiled UTSW 6 134507558 nonsense probably null
PIT4494001:Lrp6 UTSW 6 134479778 missense probably damaging 1.00
R0008:Lrp6 UTSW 6 134485753 missense probably damaging 0.96
R0008:Lrp6 UTSW 6 134485753 missense probably damaging 0.96
R0201:Lrp6 UTSW 6 134450897 nonsense probably null
R0295:Lrp6 UTSW 6 134457693 missense probably benign 0.02
R0370:Lrp6 UTSW 6 134479766 missense probably damaging 1.00
R0382:Lrp6 UTSW 6 134467668 missense probably damaging 1.00
R0413:Lrp6 UTSW 6 134507624 missense probably damaging 0.99
R0468:Lrp6 UTSW 6 134485661 missense possibly damaging 0.94
R0492:Lrp6 UTSW 6 134480518 missense possibly damaging 0.58
R0584:Lrp6 UTSW 6 134456076 missense probably damaging 0.99
R0631:Lrp6 UTSW 6 134479775 missense possibly damaging 0.95
R0738:Lrp6 UTSW 6 134542045 missense probably benign 0.13
R0907:Lrp6 UTSW 6 134507525 missense probably damaging 0.96
R1273:Lrp6 UTSW 6 134467507 critical splice donor site probably null
R1548:Lrp6 UTSW 6 134459429 missense possibly damaging 0.89
R1639:Lrp6 UTSW 6 134453566 missense possibly damaging 0.68
R1650:Lrp6 UTSW 6 134468769 missense probably benign 0.01
R1696:Lrp6 UTSW 6 134468723 missense probably damaging 1.00
R1751:Lrp6 UTSW 6 134464568 missense probably damaging 1.00
R1780:Lrp6 UTSW 6 134464451 missense probably damaging 0.99
R2013:Lrp6 UTSW 6 134480374 critical splice donor site probably null
R2015:Lrp6 UTSW 6 134480374 critical splice donor site probably null
R2165:Lrp6 UTSW 6 134459283 missense probably damaging 1.00
R2294:Lrp6 UTSW 6 134457742 missense probably damaging 1.00
R2336:Lrp6 UTSW 6 134507583 missense probably damaging 0.97
R2964:Lrp6 UTSW 6 134467526 missense probably damaging 1.00
R3716:Lrp6 UTSW 6 134507447 missense probably damaging 1.00
R4017:Lrp6 UTSW 6 134520550 missense probably damaging 1.00
R4370:Lrp6 UTSW 6 134506358 nonsense probably null
R4521:Lrp6 UTSW 6 134485862 missense probably damaging 1.00
R4573:Lrp6 UTSW 6 134470730 nonsense probably null
R4645:Lrp6 UTSW 6 134484250 missense probably damaging 1.00
R4661:Lrp6 UTSW 6 134511267 missense probably benign
R4688:Lrp6 UTSW 6 134479743 missense probably damaging 1.00
R4784:Lrp6 UTSW 6 134479539 missense probably benign 0.06
R5236:Lrp6 UTSW 6 134511264 missense probably damaging 1.00
R5506:Lrp6 UTSW 6 134459296 missense probably benign 0.09
R6001:Lrp6 UTSW 6 134464518 missense probably benign 0.03
R6319:Lrp6 UTSW 6 134541835 missense possibly damaging 0.46
R6537:Lrp6 UTSW 6 134480495 missense probably benign
R6552:Lrp6 UTSW 6 134454729 missense probably benign 0.17
R6559:Lrp6 UTSW 6 134513254 missense probably damaging 1.00
R6575:Lrp6 UTSW 6 134541971 missense possibly damaging 0.80
R6585:Lrp6 UTSW 6 134507558 nonsense probably null
R6700:Lrp6 UTSW 6 134479560 missense probably damaging 1.00
R6724:Lrp6 UTSW 6 134486541 missense possibly damaging 0.94
R7159:Lrp6 UTSW 6 134507551 missense probably benign
R7266:Lrp6 UTSW 6 134507401 missense probably damaging 1.00
R7341:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7342:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7348:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7359:Lrp6 UTSW 6 134450960 nonsense probably null
R7368:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATGAAGCCATGTCTTGTTTC -3'
(R):5'- TAAGTCTTATGGGGAAGCGC -3'

Sequencing Primer
(F):5'- GTTTCTTACAGCACAGCAGC -3'
(R):5'- GGAAGCGCTTGGATTTCCCTTAC -3'
Posted On2016-10-05