Incidental Mutation 'R5508:Xpo1'
ID431041
Institutional Source Beutler Lab
Gene Symbol Xpo1
Ensembl Gene ENSMUSG00000020290
Gene Nameexportin 1
SynonymsCrm1
MMRRC Submission 043069-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5508 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location23256041-23298249 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23294645 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1008 (I1008V)
Ref Sequence ENSEMBL: ENSMUSP00000105178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020538] [ENSMUST00000102869] [ENSMUST00000102870] [ENSMUST00000109551]
PDB Structure
Crystal Structure of the Nuclear Export Complex CRM1-Snurportin1-RanGTP [X-RAY DIFFRACTION]
Crystal structure of the PKI NES-CRM1-RanGTP nuclear export complex [X-RAY DIFFRACTION]
Crystal structure of the HIV-1 Rev NES-CRM1-RanGTP nuclear export complex (crystal I) [X-RAY DIFFRACTION]
Crystal structure of the HIV-1 Rev NES-CRM1-RanGTP nuclear export complex (crystal II) [X-RAY DIFFRACTION]
Crystal structure of the CRM1-RanGTP complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000020538
AA Change: I1008V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020538
Gene: ENSMUSG00000020290
AA Change: I1008V

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 1.3e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102869
AA Change: I1008V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099933
Gene: ENSMUSG00000020290
AA Change: I1008V

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 7.4e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102870
AA Change: I1008V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099934
Gene: ENSMUSG00000020290
AA Change: I1008V

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 1.3e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109551
AA Change: I1008V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105178
Gene: ENSMUSG00000020290
AA Change: I1008V

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 1.3e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.7%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This cell-cycle-regulated gene encodes a protein that mediates leucine-rich nuclear export signal (NES)-dependent protein transport. The protein specifically inhibits the nuclear export of Rev and U snRNAs. It is involved in the control of several cellular processes by controlling the localization of cyclin B, MPAK, and MAPKAP kinase 2. This protein also regulates NFAT and AP-1. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Apc A G 18: 34,298,580 D344G probably damaging Het
Asphd2 A T 5: 112,386,783 F300I probably damaging Het
BC016579 T A 16: 45,633,006 T149S possibly damaging Het
Bcl6b A T 11: 70,226,093 H453Q probably damaging Het
Clec4b2 A G 6: 123,173,042 probably benign Het
Crispld1 G T 1: 17,752,983 C396F probably damaging Het
Dnase1l3 A G 14: 7,968,146 V253A probably damaging Het
Efhd1 A G 1: 87,309,794 *241W probably null Het
Flvcr1 C T 1: 191,025,459 G212D probably damaging Het
Golga2 T A 2: 32,288,187 L36* probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf3c2 G T 5: 31,174,461 C4* probably null Het
Kit G T 5: 75,649,548 C786F probably damaging Het
Klf14 T C 6: 30,958,042 H219R probably damaging Het
Large2 A G 2: 92,369,903 V122A possibly damaging Het
Lct G A 1: 128,294,131 A1557V probably damaging Het
Lrp6 T G 6: 134,464,516 K1162N probably benign Het
Mtmr11 G A 3: 96,163,767 R147Q probably damaging Het
Pbld2 T A 10: 63,066,665 probably null Het
Pcdhb3 A T 18: 37,301,126 L48F probably damaging Het
Pdcd2 C T 17: 15,521,739 D310N probably damaging Het
Phlpp1 G T 1: 106,364,390 R993L probably benign Het
Prr36 G A 8: 4,216,488 P21S probably damaging Het
Ptprq C A 10: 107,686,231 V620L probably benign Het
Ranbp2 T A 10: 58,480,005 D2182E probably damaging Het
Sass6 G A 3: 116,620,103 R485K probably benign Het
Scoc A T 8: 83,435,942 S68T probably damaging Het
Speer3 T A 5: 13,794,664 L114I probably damaging Het
Ss18l1 C G 2: 180,057,653 Q215E probably damaging Het
Stab2 T C 10: 86,960,279 N368S probably benign Het
Trim80 T A 11: 115,445,078 S275R probably benign Het
Tubb5 T C 17: 35,835,070 N416S probably benign Het
Ugt2a3 A T 5: 87,327,200 M395K probably damaging Het
Vmn2r61 T A 7: 42,266,818 M285K possibly damaging Het
Other mutations in Xpo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Xpo1 APN 11 23285094 missense probably damaging 1.00
IGL01464:Xpo1 APN 11 23267703 missense probably damaging 0.97
IGL01561:Xpo1 APN 11 23282706 missense possibly damaging 0.76
IGL01630:Xpo1 APN 11 23285846 missense probably benign 0.00
IGL01700:Xpo1 APN 11 23276422 splice site probably benign
IGL02000:Xpo1 APN 11 23296003 missense probably damaging 1.00
IGL02299:Xpo1 APN 11 23293915 splice site probably benign
IGL02313:Xpo1 APN 11 23277065 missense probably damaging 1.00
IGL02828:Xpo1 APN 11 23282593 missense probably damaging 0.97
IGL03210:Xpo1 APN 11 23278834 missense probably benign 0.01
IGL03329:Xpo1 APN 11 23284306 missense probably benign
PIT1430001:Xpo1 UTSW 11 23276437 missense possibly damaging 0.66
R0507:Xpo1 UTSW 11 23294682 missense possibly damaging 0.61
R0594:Xpo1 UTSW 11 23280402 missense probably damaging 1.00
R0706:Xpo1 UTSW 11 23280441 missense probably benign 0.09
R0742:Xpo1 UTSW 11 23294682 missense possibly damaging 0.61
R1385:Xpo1 UTSW 11 23261863 missense probably damaging 0.96
R1478:Xpo1 UTSW 11 23291623 missense probably damaging 0.99
R1483:Xpo1 UTSW 11 23284863 missense probably benign 0.04
R1694:Xpo1 UTSW 11 23281399 missense probably benign 0.12
R1775:Xpo1 UTSW 11 23271193 missense probably benign
R1827:Xpo1 UTSW 11 23285155 missense probably benign 0.00
R2262:Xpo1 UTSW 11 23284634 unclassified probably null
R2263:Xpo1 UTSW 11 23284634 unclassified probably null
R4510:Xpo1 UTSW 11 23287401 missense possibly damaging 0.60
R4511:Xpo1 UTSW 11 23287401 missense possibly damaging 0.60
R4840:Xpo1 UTSW 11 23278183 missense probably damaging 1.00
R4901:Xpo1 UTSW 11 23281327 missense possibly damaging 0.62
R5176:Xpo1 UTSW 11 23295977 missense probably damaging 0.99
R5927:Xpo1 UTSW 11 23268653 unclassified probably benign
R5927:Xpo1 UTSW 11 23268656 unclassified probably benign
R6110:Xpo1 UTSW 11 23287434 missense probably damaging 0.99
R6421:Xpo1 UTSW 11 23291490 missense possibly damaging 0.60
R6591:Xpo1 UTSW 11 23286875 missense probably damaging 1.00
R6691:Xpo1 UTSW 11 23286875 missense probably damaging 1.00
R6698:Xpo1 UTSW 11 23294040 missense probably benign 0.01
R6958:Xpo1 UTSW 11 23285855 missense probably benign
R7407:Xpo1 UTSW 11 23285823 missense probably damaging 1.00
R7482:Xpo1 UTSW 11 23282544 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAATGGACCCTAGATCACCAGG -3'
(R):5'- CAGGACCTTGCTGGGTATTTAG -3'

Sequencing Primer
(F):5'- CCTAGATCACCAGGCTTTAGAGG -3'
(R):5'- AGTCTTAAATGGGTGAGCTTTAGAG -3'
Posted On2016-10-05