Incidental Mutation 'R5508:1700011I03Rik'
List |< first << previous [record 53 of 32981] next >> last >|
ID431051
Institutional Source Beutler Lab
Gene Symbol 1700011I03Rik
Ensembl Gene ENSMUSG00000058925
Gene NameRIKEN cDNA 1700011I03 gene
Synonyms
MMRRC Submission 043069-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R5508 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location57533780-57731065 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 57538084 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079738] [ENSMUST00000135806]
Predicted Effect probably null
Transcript: ENSMUST00000079738
SMART Domains Protein: ENSMUSP00000078674
Gene: ENSMUSG00000058925

DomainStartEndE-ValueType
coiled coil region 68 177 N/A INTRINSIC
coiled coil region 220 260 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000127130
SMART Domains Protein: ENSMUSP00000117563
Gene: ENSMUSG00000058925

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133147
Predicted Effect probably null
Transcript: ENSMUST00000135806
SMART Domains Protein: ENSMUSP00000115752
Gene: ENSMUSG00000058925

DomainStartEndE-ValueType
coiled coil region 68 151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150186
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153122
Meta Mutation Damage Score 0.6156 question?
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.7%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Apc A G 18: 34,298,580 D344G probably damaging Het
Asphd2 A T 5: 112,386,783 F300I probably damaging Het
BC016579 T A 16: 45,633,006 T149S possibly damaging Het
Bcl6b A T 11: 70,226,093 H453Q probably damaging Het
Clec4b2 A G 6: 123,173,042 probably benign Het
Crispld1 G T 1: 17,752,983 C396F probably damaging Het
Dnase1l3 A G 14: 7,968,146 V253A probably damaging Het
Efhd1 A G 1: 87,309,794 *241W probably null Het
Flvcr1 C T 1: 191,025,459 G212D probably damaging Het
Golga2 T A 2: 32,288,187 L36* probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf3c2 G T 5: 31,174,461 C4* probably null Het
Kit G T 5: 75,649,548 C786F probably damaging Het
Klf14 T C 6: 30,958,042 H219R probably damaging Het
Large2 A G 2: 92,369,903 V122A possibly damaging Het
Lct G A 1: 128,294,131 A1557V probably damaging Het
Lrp6 T G 6: 134,464,516 K1162N probably benign Het
Mtmr11 G A 3: 96,163,767 R147Q probably damaging Het
Pbld2 T A 10: 63,066,665 probably null Het
Pcdhb3 A T 18: 37,301,126 L48F probably damaging Het
Pdcd2 C T 17: 15,521,739 D310N probably damaging Het
Phlpp1 G T 1: 106,364,390 R993L probably benign Het
Prr36 G A 8: 4,216,488 P21S probably damaging Het
Ptprq C A 10: 107,686,231 V620L probably benign Het
Ranbp2 T A 10: 58,480,005 D2182E probably damaging Het
Sass6 G A 3: 116,620,103 R485K probably benign Het
Scoc A T 8: 83,435,942 S68T probably damaging Het
Speer3 T A 5: 13,794,664 L114I probably damaging Het
Ss18l1 C G 2: 180,057,653 Q215E probably damaging Het
Stab2 T C 10: 86,960,279 N368S probably benign Het
Trim80 T A 11: 115,445,078 S275R probably benign Het
Tubb5 T C 17: 35,835,070 N416S probably benign Het
Ugt2a3 A T 5: 87,327,200 M395K probably damaging Het
Vmn2r61 T A 7: 42,266,818 M285K possibly damaging Het
Xpo1 A G 11: 23,294,645 I1008V probably benign Het
Other mutations in 1700011I03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:1700011I03Rik APN 18 57594086 missense probably damaging 0.98
IGL01646:1700011I03Rik APN 18 57667345 nonsense probably null
R0115:1700011I03Rik UTSW 18 57594142 splice site probably benign
R0285:1700011I03Rik UTSW 18 57533865 missense probably damaging 0.99
R1087:1700011I03Rik UTSW 18 57730798 missense probably damaging 0.96
R1923:1700011I03Rik UTSW 18 57533887 missense probably damaging 0.99
R4927:1700011I03Rik UTSW 18 57730816 nonsense probably null
R5133:1700011I03Rik UTSW 18 57563969 missense possibly damaging 0.92
R5509:1700011I03Rik UTSW 18 57538084 splice site probably null
R5510:1700011I03Rik UTSW 18 57538084 splice site probably null
R5511:1700011I03Rik UTSW 18 57538084 splice site probably null
R6629:1700011I03Rik UTSW 18 57730780 missense possibly damaging 0.53
X0021:1700011I03Rik UTSW 18 57594125 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCTATTCAATGTGAGATCTCTCCC -3'
(R):5'- CAATGTGACATCCATGACGGG -3'

Sequencing Primer
(F):5'- CCCTCTCTGTATGTACGAATGTGAG -3'
(R):5'- TGGGGAAGGCTACACACTATATCAC -3'
Posted On2016-10-05