Incidental Mutation 'R5509:Atp9a'
ID431059
Institutional Source Beutler Lab
Gene Symbol Atp9a
Ensembl Gene ENSMUSG00000027546
Gene NameATPase, class II, type 9A
SynonymsClass II, IIa
MMRRC Submission 043070-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.487) question?
Stock #R5509 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location168634438-168742409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 168639937 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 879 (D879G)
Ref Sequence ENSEMBL: ENSMUSP00000104806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029060] [ENSMUST00000109175] [ENSMUST00000109176] [ENSMUST00000109177] [ENSMUST00000178504]
Predicted Effect probably damaging
Transcript: ENSMUST00000029060
AA Change: D897G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029060
Gene: ENSMUSG00000027546
AA Change: D897G

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
Pfam:E1-E2_ATPase 108 368 7.4e-21 PFAM
Pfam:Hydrolase 385 797 1.5e-19 PFAM
Pfam:HAD 388 794 1.1e-14 PFAM
Pfam:Hydrolase_like2 464 579 3.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109175
AA Change: D881G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104804
Gene: ENSMUSG00000027546
AA Change: D881G

DomainStartEndE-ValueType
low complexity region 57 72 N/A INTRINSIC
Pfam:E1-E2_ATPase 92 352 7.2e-21 PFAM
Pfam:Hydrolase 369 781 1.4e-19 PFAM
Pfam:HAD 372 778 1.1e-14 PFAM
Pfam:Hydrolase_like2 448 563 3.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109176
AA Change: D955G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104805
Gene: ENSMUSG00000027546
AA Change: D955G

DomainStartEndE-ValueType
low complexity region 18 57 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 97 163 1.9e-20 PFAM
Pfam:E1-E2_ATPase 166 418 5.8e-13 PFAM
Pfam:Hydrolase 443 855 2.8e-13 PFAM
Pfam:HAD 446 852 2.4e-14 PFAM
Pfam:Cation_ATPase 522 635 1.5e-6 PFAM
Pfam:PhoLip_ATPase_C 869 1098 1.7e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109177
AA Change: D879G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104806
Gene: ENSMUSG00000027546
AA Change: D879G

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
Pfam:E1-E2_ATPase 90 350 7.2e-21 PFAM
Pfam:Hydrolase 367 779 1.4e-19 PFAM
Pfam:HAD 370 776 1.1e-14 PFAM
Pfam:Hydrolase_like2 446 561 3.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178504
AA Change: D897G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136793
Gene: ENSMUSG00000027546
AA Change: D897G

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
Pfam:E1-E2_ATPase 108 368 7.4e-21 PFAM
Pfam:Hydrolase 385 797 1.5e-19 PFAM
Pfam:HAD 388 794 1.1e-14 PFAM
Pfam:Hydrolase_like2 464 579 3.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200215
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
Abcc10 G C 17: 46,324,259 Q273E probably benign Het
Acly C T 11: 100,514,979 R329Q probably damaging Het
Acsm2 T C 7: 119,573,617 S152P probably damaging Het
Adamtsl4 A T 3: 95,681,357 I515N probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Bmp8b G A 4: 123,114,576 D112N possibly damaging Het
Camk2d T C 3: 126,840,316 W496R probably damaging Het
Cflar T C 1: 58,752,392 F285L probably benign Het
Cox16 T C 12: 81,472,258 T176A probably benign Het
Cux1 G T 5: 136,275,317 A1214D probably benign Het
Cyb5d1 C A 11: 69,393,735 probably null Het
Dennd6b G A 15: 89,185,022 P575S probably damaging Het
Fbxl2 A T 9: 113,985,347 probably null Het
Gfpt2 T C 11: 49,827,146 F483L possibly damaging Het
Glrx3 T C 7: 137,445,022 C48R probably damaging Het
Invs G A 4: 48,396,337 V281M probably damaging Het
Kif13a G A 13: 46,752,115 A784V probably benign Het
Kmt2d T C 15: 98,839,676 probably benign Het
Lmod2 A G 6: 24,603,889 T288A probably damaging Het
Lrrc37a T C 11: 103,500,535 K1355E probably benign Het
Magi3 A T 3: 104,015,502 S1300T probably benign Het
Mdm2 A C 10: 117,690,612 D307E probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mroh4 T C 15: 74,606,154 Y901C probably benign Het
Mtmr14 G T 6: 113,253,807 probably null Het
Mug2 A T 6: 122,084,381 Q1420L possibly damaging Het
Net1 T C 13: 3,884,320 Q459R probably benign Het
Nle1 T C 11: 82,903,182 R343G possibly damaging Het
Npat C A 9: 53,570,242 N1083K probably benign Het
Nrp1 G A 8: 128,425,915 G202R possibly damaging Het
Nsun4 C T 4: 116,051,777 V529I possibly damaging Het
Olfr1427 T A 19: 12,098,977 I221F possibly damaging Het
Olfr1472 A T 19: 13,453,968 L183Q probably damaging Het
Olfr32 T A 2: 90,138,892 L82F probably damaging Het
Olfr935 T C 9: 38,994,628 D269G probably benign Het
Podxl A T 6: 31,526,613 N264K probably benign Het
Ptprm C T 17: 66,689,358 A1245T probably damaging Het
Rdh12 T A 12: 79,210,784 probably null Het
Ryr2 T A 13: 11,745,601 Y1532F probably damaging Het
Senp2 T C 16: 22,040,522 F441S probably damaging Het
Snap23 C A 2: 120,594,865 P111T probably benign Het
Sox2 A G 3: 34,650,789 D125G probably damaging Het
Syne2 T C 12: 75,921,244 W923R probably damaging Het
Tbc1d2b T C 9: 90,218,969 E656G probably damaging Het
Tbcd A G 11: 121,602,012 T892A probably benign Het
Tg A G 15: 66,827,293 I24V probably benign Het
Trpm3 A T 19: 22,987,258 K1372N probably damaging Het
Ubc A T 5: 125,387,275 N329K probably benign Het
Vmn2r106 T A 17: 20,278,422 H409L probably damaging Het
Wdfy3 T A 5: 101,861,448 N2751Y possibly damaging Het
Zfp518a T A 19: 40,915,401 I1258K possibly damaging Het
Zfp91 T C 19: 12,779,087 E131G probably damaging Het
Zfyve26 T A 12: 79,246,521 R2027W probably damaging Het
Other mutations in Atp9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Atp9a APN 2 168640680 missense probably benign 0.24
IGL01594:Atp9a APN 2 168691012 missense probably damaging 1.00
IGL01911:Atp9a APN 2 168653561 missense probably damaging 1.00
IGL02606:Atp9a APN 2 168652668 missense probably damaging 1.00
IGL02639:Atp9a APN 2 168649620 missense probably damaging 1.00
IGL03011:Atp9a APN 2 168652632 missense probably damaging 1.00
IGL03294:Atp9a APN 2 168689305 missense probably benign 0.04
IGL03310:Atp9a APN 2 168639959 missense probably damaging 1.00
R0114:Atp9a UTSW 2 168710856 nonsense probably null
R0194:Atp9a UTSW 2 168643885 missense probably benign 0.00
R0427:Atp9a UTSW 2 168640697 critical splice acceptor site probably null
R0508:Atp9a UTSW 2 168649526 splice site probably null
R1611:Atp9a UTSW 2 168673569 missense probably damaging 1.00
R2120:Atp9a UTSW 2 168653537 missense probably damaging 1.00
R2330:Atp9a UTSW 2 168639929 missense probably benign 0.01
R2348:Atp9a UTSW 2 168710826 splice site probably benign
R2404:Atp9a UTSW 2 168675363 critical splice acceptor site probably null
R2881:Atp9a UTSW 2 168706214 missense probably damaging 1.00
R2882:Atp9a UTSW 2 168706214 missense probably damaging 1.00
R4029:Atp9a UTSW 2 168689325 missense probably damaging 1.00
R4371:Atp9a UTSW 2 168649615 missense probably damaging 1.00
R4411:Atp9a UTSW 2 168661933 missense probably damaging 1.00
R4446:Atp9a UTSW 2 168681997 missense possibly damaging 0.75
R4583:Atp9a UTSW 2 168689360 splice site probably null
R4626:Atp9a UTSW 2 168639943 missense probably damaging 1.00
R4661:Atp9a UTSW 2 168637672 missense possibly damaging 0.52
R4679:Atp9a UTSW 2 168661964 missense possibly damaging 0.95
R4738:Atp9a UTSW 2 168668181 missense probably benign
R5191:Atp9a UTSW 2 168662063 missense possibly damaging 0.51
R5216:Atp9a UTSW 2 168674888 missense probably benign 0.38
R5280:Atp9a UTSW 2 168639988 missense possibly damaging 0.66
R5798:Atp9a UTSW 2 168690964 critical splice donor site probably null
R5807:Atp9a UTSW 2 168653534 missense probably damaging 0.98
R5926:Atp9a UTSW 2 168706271 missense probably damaging 1.00
R6046:Atp9a UTSW 2 168634870 missense probably benign 0.42
R6244:Atp9a UTSW 2 168689352 critical splice acceptor site probably null
R6307:Atp9a UTSW 2 168668170 missense probably benign 0.02
R6345:Atp9a UTSW 2 168676173 missense probably damaging 0.99
R6442:Atp9a UTSW 2 168649561 missense probably benign 0.01
R6459:Atp9a UTSW 2 168668013 missense probably damaging 1.00
R6769:Atp9a UTSW 2 168674900 missense probably damaging 1.00
R6771:Atp9a UTSW 2 168674900 missense probably damaging 1.00
R6841:Atp9a UTSW 2 168654220 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGAAACACACGCTGTTGGC -3'
(R):5'- TCTCTAGTGCTAAGACCTGGG -3'

Sequencing Primer
(F):5'- ACACGCTGTTGGCAGTCTG -3'
(R):5'- CTAAGACCTGGGCGTGGTG -3'
Posted On2016-10-05