Incidental Mutation 'R5509:1700011I03Rik'
List |< first << previous [record 33 of 19097] next >> last >|
ID431108
Institutional Source Beutler Lab
Gene Symbol 1700011I03Rik
Ensembl Gene ENSMUSG00000058925
Gene NameRIKEN cDNA 1700011I03 gene
Synonyms
MMRRC Submission 043070-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R5509 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location57533780-57731065 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 57538084 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079738] [ENSMUST00000135806]
Predicted Effect probably null
Transcript: ENSMUST00000079738
SMART Domains Protein: ENSMUSP00000078674
Gene: ENSMUSG00000058925

DomainStartEndE-ValueType
coiled coil region 68 177 N/A INTRINSIC
coiled coil region 220 260 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000127130
SMART Domains Protein: ENSMUSP00000117563
Gene: ENSMUSG00000058925

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133147
Predicted Effect probably null
Transcript: ENSMUST00000135806
SMART Domains Protein: ENSMUSP00000115752
Gene: ENSMUSG00000058925

DomainStartEndE-ValueType
coiled coil region 68 151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150186
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153122
Meta Mutation Damage Score 0.6156 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 G C 17: 46,324,259 Q273E probably benign Het
Acly C T 11: 100,514,979 R329Q probably damaging Het
Acsm2 T C 7: 119,573,617 S152P probably damaging Het
Adamtsl4 A T 3: 95,681,357 I515N probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Atp9a T C 2: 168,639,937 D879G probably damaging Het
Bmp8b G A 4: 123,114,576 D112N possibly damaging Het
Camk2d T C 3: 126,840,316 W496R probably damaging Het
Cflar T C 1: 58,752,392 F285L probably benign Het
Cox16 T C 12: 81,472,258 T176A probably benign Het
Cux1 G T 5: 136,275,317 A1214D probably benign Het
Cyb5d1 C A 11: 69,393,735 probably null Het
Dennd6b G A 15: 89,185,022 P575S probably damaging Het
Fbxl2 A T 9: 113,985,347 probably null Het
Gfpt2 T C 11: 49,827,146 F483L possibly damaging Het
Glrx3 T C 7: 137,445,022 C48R probably damaging Het
Invs G A 4: 48,396,337 V281M probably damaging Het
Kif13a G A 13: 46,752,115 A784V probably benign Het
Kmt2d T C 15: 98,839,676 probably benign Het
Lmod2 A G 6: 24,603,889 T288A probably damaging Het
Lrrc37a T C 11: 103,500,535 K1355E probably benign Het
Magi3 A T 3: 104,015,502 S1300T probably benign Het
Mdm2 A C 10: 117,690,612 D307E probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mroh4 T C 15: 74,606,154 Y901C probably benign Het
Mtmr14 G T 6: 113,253,807 probably null Het
Mug2 A T 6: 122,084,381 Q1420L possibly damaging Het
Net1 T C 13: 3,884,320 Q459R probably benign Het
Nle1 T C 11: 82,903,182 R343G possibly damaging Het
Npat C A 9: 53,570,242 N1083K probably benign Het
Nrp1 G A 8: 128,425,915 G202R possibly damaging Het
Nsun4 C T 4: 116,051,777 V529I possibly damaging Het
Olfr1427 T A 19: 12,098,977 I221F possibly damaging Het
Olfr1472 A T 19: 13,453,968 L183Q probably damaging Het
Olfr32 T A 2: 90,138,892 L82F probably damaging Het
Olfr935 T C 9: 38,994,628 D269G probably benign Het
Podxl A T 6: 31,526,613 N264K probably benign Het
Ptprm C T 17: 66,689,358 A1245T probably damaging Het
Rdh12 T A 12: 79,210,784 probably null Het
Ryr2 T A 13: 11,745,601 Y1532F probably damaging Het
Senp2 T C 16: 22,040,522 F441S probably damaging Het
Snap23 C A 2: 120,594,865 P111T probably benign Het
Sox2 A G 3: 34,650,789 D125G probably damaging Het
Syne2 T C 12: 75,921,244 W923R probably damaging Het
Tbc1d2b T C 9: 90,218,969 E656G probably damaging Het
Tbcd A G 11: 121,602,012 T892A probably benign Het
Tg A G 15: 66,827,293 I24V probably benign Het
Trpm3 A T 19: 22,987,258 K1372N probably damaging Het
Ubc A T 5: 125,387,275 N329K probably benign Het
Vmn2r106 T A 17: 20,278,422 H409L probably damaging Het
Wdfy3 T A 5: 101,861,448 N2751Y possibly damaging Het
Zfp518a T A 19: 40,915,401 I1258K possibly damaging Het
Zfp91 T C 19: 12,779,087 E131G probably damaging Het
Zfyve26 T A 12: 79,246,521 R2027W probably damaging Het
Other mutations in 1700011I03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:1700011I03Rik APN 18 57594086 missense probably damaging 0.98
IGL01646:1700011I03Rik APN 18 57667345 nonsense probably null
R0115:1700011I03Rik UTSW 18 57594142 splice site probably benign
R0285:1700011I03Rik UTSW 18 57533865 missense probably damaging 0.99
R1087:1700011I03Rik UTSW 18 57730798 missense probably damaging 0.96
R1923:1700011I03Rik UTSW 18 57533887 missense probably damaging 0.99
R4927:1700011I03Rik UTSW 18 57730816 nonsense probably null
R5133:1700011I03Rik UTSW 18 57563969 missense possibly damaging 0.92
R5508:1700011I03Rik UTSW 18 57538084 splice site probably null
R5510:1700011I03Rik UTSW 18 57538084 splice site probably null
R5511:1700011I03Rik UTSW 18 57538084 splice site probably null
R6629:1700011I03Rik UTSW 18 57730780 missense possibly damaging 0.53
X0021:1700011I03Rik UTSW 18 57594125 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCTATTCAATGTGAGATCTCTCCC -3'
(R):5'- AATGTGACATCCATGACGGG -3'

Sequencing Primer
(F):5'- CCCTCTCTGTATGTACGAATGTGAG -3'
(R):5'- TGGGGAAGGCTACACACTATATCAC -3'
Posted On2016-10-05