Incidental Mutation 'R5510:Ppp1r12a'
ID431164
Institutional Source Beutler Lab
Gene Symbol Ppp1r12a
Ensembl Gene ENSMUSG00000019907
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 12A
Synonyms1200015F06Rik, 5730577I22Rik, Mypt1, D10Ertd625e
MMRRC Submission 043071-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5510 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location108162193-108284475 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108249627 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 478 (S478T)
Ref Sequence ENSEMBL: ENSMUSP00000151842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070663] [ENSMUST00000219263] [ENSMUST00000219759]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070663
AA Change: S478T

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000069257
Gene: ENSMUSG00000019907
AA Change: S478T

DomainStartEndE-ValueType
ANK 38 68 1.01e2 SMART
ANK 72 101 1.66e-6 SMART
ANK 105 134 6.36e-3 SMART
ANK 138 168 5.52e2 SMART
ANK 198 227 6.12e-5 SMART
ANK 231 260 5.16e-3 SMART
coiled coil region 333 354 N/A INTRINSIC
low complexity region 385 402 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
low complexity region 517 531 N/A INTRINSIC
low complexity region 564 578 N/A INTRINSIC
low complexity region 596 610 N/A INTRINSIC
low complexity region 626 656 N/A INTRINSIC
PDB:2KJY|A 657 712 5e-12 PDB
low complexity region 719 745 N/A INTRINSIC
low complexity region 771 794 N/A INTRINSIC
low complexity region 815 833 N/A INTRINSIC
low complexity region 836 851 N/A INTRINSIC
low complexity region 883 902 N/A INTRINSIC
Pfam:PRKG1_interact 930 993 4.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219068
Predicted Effect possibly damaging
Transcript: ENSMUST00000219263
AA Change: S478T

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000219759
AA Change: S12T

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.24 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.1%
Validation Efficiency 99% (91/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin phosphatase target subunit 1, which is also called the myosin-binding subunit of myosin phosphatase, is one of the subunits of myosin phosphatase. Myosin phosphatase regulates the interaction of actin and myosin downstream of the guanosine triphosphatase Rho. The small guanosine triphosphatase Rho is implicated in myosin light chain (MLC) phosphorylation, which results in contraction of smooth muscle and interaction of actin and myosin in nonmuscle cells. The guanosine triphosphate (GTP)-bound, active form of RhoA (GTP.RhoA) specifically interacted with the myosin-binding subunit (MBS) of myosin phosphatase, which regulates the extent of phosphorylation of MLC. Rho-associated kinase (Rho-kinase), which is activated by GTP. RhoA, phosphorylated MBS and consequently inactivated myosin phosphatase. Overexpression of RhoA or activated RhoA in NIH 3T3 cells increased phosphorylation of MBS and MLC. Thus, Rho appears to inhibit myosin phosphatase through the action of Rho-kinase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous null mice die before E7.5. Mice homozygous for a floxed allele activated in smooth muscle exhibit altered intestinal smooth muscle contractility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
1700014D04Rik T C 13: 59,742,420 probably null Het
Adgrl4 T G 3: 151,497,830 I59R possibly damaging Het
Adgrv1 T A 13: 81,445,244 D4208V probably damaging Het
Aimp2 A T 5: 143,906,529 probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ankib1 A G 5: 3,729,693 V392A probably benign Het
Ap2b1 A G 11: 83,336,737 probably null Het
Arsg A G 11: 109,527,874 E232G probably benign Het
Axdnd1 A G 1: 156,335,350 F144S probably benign Het
Bud13 T A 9: 46,292,200 M111K probably damaging Het
Cav2 T C 6: 17,287,013 F152S possibly damaging Het
Ccdc180 A G 4: 45,928,046 T1194A probably damaging Het
Ccdc88c T C 12: 100,945,031 K848R probably damaging Het
Ceacam15 A G 7: 16,672,099 W176R probably damaging Het
Cenpf A T 1: 189,682,903 D136E probably benign Het
Dclk2 T C 3: 86,906,037 I201V possibly damaging Het
Defa24 T A 8: 21,734,596 D20E probably damaging Het
Dgcr8 T C 16: 18,277,175 N566D probably damaging Het
Dido1 C A 2: 180,685,173 V386L probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dtx3 G A 10: 127,192,938 P141S probably benign Het
Fmn1 T C 2: 113,596,369 Y1144H probably damaging Het
Gabbr2 A G 4: 46,734,113 L535P probably damaging Het
Gimap3 T A 6: 48,765,249 E249V possibly damaging Het
Git2 A T 5: 114,743,774 probably null Het
Gm4922 T C 10: 18,783,997 T326A probably benign Het
Gsdmc2 T G 15: 63,828,196 E242D probably benign Het
Hdgfl2 G A 17: 56,082,118 G31S possibly damaging Het
Herc2 A T 7: 56,206,771 I3956F probably damaging Het
Hsf2bp G A 17: 31,946,747 R134C unknown Het
Igf1r G C 7: 68,193,359 R739S probably benign Het
Igkv4-51 T C 6: 69,681,459 E102G probably damaging Het
Kif1a T G 1: 93,041,692 I1156L possibly damaging Het
Kti12 T C 4: 108,848,624 L245S probably damaging Het
Med17 A G 9: 15,270,404 S17P probably benign Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mrps18b A G 17: 35,914,323 probably benign Het
Ms4a8a A G 19: 11,079,464 S85P probably benign Het
Msln T C 17: 25,749,873 Q487R probably benign Het
Myh13 A G 11: 67,337,723 N363S probably benign Het
Myo6 T C 9: 80,245,660 F192L probably damaging Het
Nfkbiz T C 16: 55,814,020 D688G probably damaging Het
Nsun4 C T 4: 116,051,777 V529I possibly damaging Het
Olfr105-ps A T 17: 37,383,301 M245L probably benign Het
Olfr345 G A 2: 36,640,963 R308K probably benign Het
Olfr495 G A 7: 108,395,125 A2T probably benign Het
Phf11a C A 14: 59,279,385 C208F probably damaging Het
Plekhh2 G A 17: 84,566,847 C520Y probably benign Het
Plxna4 C A 6: 32,178,358 M1550I probably damaging Het
Pnpla6 A T 8: 3,521,397 Y140F probably damaging Het
Prkcz C A 4: 155,272,936 probably null Het
Prss55 T A 14: 64,077,125 M199L probably damaging Het
Qrich1 G A 9: 108,556,460 V651I possibly damaging Het
Ralyl T C 3: 13,776,945 V47A probably damaging Het
Raph1 A T 1: 60,522,946 probably benign Het
Rgs12 T C 5: 34,966,039 Y389H probably damaging Het
Sec24b C A 3: 130,040,895 G82V probably damaging Het
Sema4a A G 3: 88,449,986 probably null Het
Slc25a11 A T 11: 70,645,535 W149R probably damaging Het
Slc2a7 T G 4: 150,160,094 S340A probably benign Het
Slc32a1 T A 2: 158,614,796 M457K probably damaging Het
Spint4 C T 2: 164,700,892 T135M probably damaging Het
Sult2a2 A C 7: 13,738,303 N142H probably damaging Het
Tbc1d1 G A 5: 64,333,395 G863D probably damaging Het
Tmem156 G A 5: 65,075,574 T151M probably benign Het
Trip12 T C 1: 84,768,680 Q459R probably damaging Het
Vmn2r116 G A 17: 23,386,121 C136Y probably damaging Het
Vmn2r51 C T 7: 10,102,618 V79M possibly damaging Het
Vmn2r67 A T 7: 85,151,815 D304E probably benign Het
Wdr93 T A 7: 79,750,031 F123I probably damaging Het
Zfp672 A T 11: 58,316,630 C288* probably null Het
Zp1 T C 19: 10,919,405 Y90C probably damaging Het
Other mutations in Ppp1r12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Ppp1r12a APN 10 108198848 missense probably damaging 1.00
IGL00727:Ppp1r12a APN 10 108230473 missense probably damaging 1.00
IGL00819:Ppp1r12a APN 10 108240821 missense probably damaging 0.98
IGL01538:Ppp1r12a APN 10 108234021 missense probably damaging 1.00
IGL02227:Ppp1r12a APN 10 108269324 missense probably damaging 1.00
IGL02957:Ppp1r12a APN 10 108198918 missense probably damaging 0.98
IGL03063:Ppp1r12a APN 10 108261254 missense probably damaging 1.00
IGL03260:Ppp1r12a APN 10 108261245 missense probably benign 0.10
R0049:Ppp1r12a UTSW 10 108253332 missense possibly damaging 0.63
R0268:Ppp1r12a UTSW 10 108273381 intron probably benign
R0826:Ppp1r12a UTSW 10 108230553 missense possibly damaging 0.46
R0839:Ppp1r12a UTSW 10 108198861 missense probably damaging 1.00
R1026:Ppp1r12a UTSW 10 108251859 missense probably benign 0.08
R1053:Ppp1r12a UTSW 10 108262351 missense probably damaging 1.00
R1376:Ppp1r12a UTSW 10 108198918 missense probably damaging 0.98
R1376:Ppp1r12a UTSW 10 108198918 missense probably damaging 0.98
R1511:Ppp1r12a UTSW 10 108251859 missense probably benign 0.08
R1616:Ppp1r12a UTSW 10 108260867 missense probably damaging 1.00
R1673:Ppp1r12a UTSW 10 108249565 missense probably damaging 0.96
R1866:Ppp1r12a UTSW 10 108262431 missense possibly damaging 0.85
R1901:Ppp1r12a UTSW 10 108198891 missense probably damaging 1.00
R1902:Ppp1r12a UTSW 10 108198891 missense probably damaging 1.00
R2233:Ppp1r12a UTSW 10 108198919 missense possibly damaging 0.83
R2234:Ppp1r12a UTSW 10 108198919 missense possibly damaging 0.83
R3760:Ppp1r12a UTSW 10 108264734 missense probably damaging 1.00
R3856:Ppp1r12a UTSW 10 108253501 intron probably benign
R3973:Ppp1r12a UTSW 10 108253480 missense probably benign 0.44
R3974:Ppp1r12a UTSW 10 108253480 missense probably benign 0.44
R3976:Ppp1r12a UTSW 10 108253480 missense probably benign 0.44
R4502:Ppp1r12a UTSW 10 108249478 missense probably benign 0.26
R4902:Ppp1r12a UTSW 10 108230590 missense probably damaging 1.00
R5092:Ppp1r12a UTSW 10 108267402 critical splice acceptor site probably null
R5224:Ppp1r12a UTSW 10 108261025 missense probably benign 0.37
R5353:Ppp1r12a UTSW 10 108261216 intron probably null
R5428:Ppp1r12a UTSW 10 108253347 missense possibly damaging 0.76
R5472:Ppp1r12a UTSW 10 108240112 missense probably damaging 1.00
R6217:Ppp1r12a UTSW 10 108240184 splice site probably null
R6274:Ppp1r12a UTSW 10 108260890 missense probably benign 0.00
R6431:Ppp1r12a UTSW 10 108262420 missense probably damaging 1.00
R6744:Ppp1r12a UTSW 10 108230534 missense probably damaging 1.00
R6838:Ppp1r12a UTSW 10 108261276 missense possibly damaging 0.76
R6865:Ppp1r12a UTSW 10 108262381 nonsense probably null
X0027:Ppp1r12a UTSW 10 108214423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTACGACCTTAACCTTAGTAAATG -3'
(R):5'- AACCTGTTCATTCCCTAGAGC -3'

Sequencing Primer
(F):5'- AACCTTAGTAAATGTGTTTTCTCCC -3'
(R):5'- GGTGCACTTCCATACATACAGG -3'
Posted On2016-10-05