Incidental Mutation 'R5510:1700011I03Rik'
List |< first << previous [record 34 of 19097] next >> last >|
ID431192
Institutional Source Beutler Lab
Gene Symbol 1700011I03Rik
Ensembl Gene ENSMUSG00000058925
Gene NameRIKEN cDNA 1700011I03 gene
Synonyms
MMRRC Submission 043071-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R5510 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location57533780-57731065 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 57538084 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079738] [ENSMUST00000135806]
Predicted Effect probably null
Transcript: ENSMUST00000079738
SMART Domains Protein: ENSMUSP00000078674
Gene: ENSMUSG00000058925

DomainStartEndE-ValueType
coiled coil region 68 177 N/A INTRINSIC
coiled coil region 220 260 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000127130
SMART Domains Protein: ENSMUSP00000117563
Gene: ENSMUSG00000058925

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133147
Predicted Effect probably null
Transcript: ENSMUST00000135806
SMART Domains Protein: ENSMUSP00000115752
Gene: ENSMUSG00000058925

DomainStartEndE-ValueType
coiled coil region 68 151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150186
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153122
Meta Mutation Damage Score 0.6156 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.1%
Validation Efficiency 99% (91/92)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,420 probably null Het
Adgrl4 T G 3: 151,497,830 I59R possibly damaging Het
Adgrv1 T A 13: 81,445,244 D4208V probably damaging Het
Aimp2 A T 5: 143,906,529 probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ankib1 A G 5: 3,729,693 V392A probably benign Het
Ap2b1 A G 11: 83,336,737 probably null Het
Arsg A G 11: 109,527,874 E232G probably benign Het
Axdnd1 A G 1: 156,335,350 F144S probably benign Het
Bud13 T A 9: 46,292,200 M111K probably damaging Het
Cav2 T C 6: 17,287,013 F152S possibly damaging Het
Ccdc180 A G 4: 45,928,046 T1194A probably damaging Het
Ccdc88c T C 12: 100,945,031 K848R probably damaging Het
Ceacam15 A G 7: 16,672,099 W176R probably damaging Het
Cenpf A T 1: 189,682,903 D136E probably benign Het
Dclk2 T C 3: 86,906,037 I201V possibly damaging Het
Defa24 T A 8: 21,734,596 D20E probably damaging Het
Dgcr8 T C 16: 18,277,175 N566D probably damaging Het
Dido1 C A 2: 180,685,173 V386L probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dtx3 G A 10: 127,192,938 P141S probably benign Het
Fmn1 T C 2: 113,596,369 Y1144H probably damaging Het
Gabbr2 A G 4: 46,734,113 L535P probably damaging Het
Gimap3 T A 6: 48,765,249 E249V possibly damaging Het
Git2 A T 5: 114,743,774 probably null Het
Gm4922 T C 10: 18,783,997 T326A probably benign Het
Gsdmc2 T G 15: 63,828,196 E242D probably benign Het
Hdgfl2 G A 17: 56,082,118 G31S possibly damaging Het
Herc2 A T 7: 56,206,771 I3956F probably damaging Het
Hsf2bp G A 17: 31,946,747 R134C unknown Het
Igf1r G C 7: 68,193,359 R739S probably benign Het
Igkv4-51 T C 6: 69,681,459 E102G probably damaging Het
Kif1a T G 1: 93,041,692 I1156L possibly damaging Het
Kti12 T C 4: 108,848,624 L245S probably damaging Het
Med17 A G 9: 15,270,404 S17P probably benign Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mrps18b A G 17: 35,914,323 probably benign Het
Ms4a8a A G 19: 11,079,464 S85P probably benign Het
Msln T C 17: 25,749,873 Q487R probably benign Het
Myh13 A G 11: 67,337,723 N363S probably benign Het
Myo6 T C 9: 80,245,660 F192L probably damaging Het
Nfkbiz T C 16: 55,814,020 D688G probably damaging Het
Nsun4 C T 4: 116,051,777 V529I possibly damaging Het
Olfr105-ps A T 17: 37,383,301 M245L probably benign Het
Olfr345 G A 2: 36,640,963 R308K probably benign Het
Olfr495 G A 7: 108,395,125 A2T probably benign Het
Phf11a C A 14: 59,279,385 C208F probably damaging Het
Plekhh2 G A 17: 84,566,847 C520Y probably benign Het
Plxna4 C A 6: 32,178,358 M1550I probably damaging Het
Pnpla6 A T 8: 3,521,397 Y140F probably damaging Het
Ppp1r12a T A 10: 108,249,627 S478T possibly damaging Het
Prkcz C A 4: 155,272,936 probably null Het
Prss55 T A 14: 64,077,125 M199L probably damaging Het
Qrich1 G A 9: 108,556,460 V651I possibly damaging Het
Ralyl T C 3: 13,776,945 V47A probably damaging Het
Raph1 A T 1: 60,522,946 probably benign Het
Rgs12 T C 5: 34,966,039 Y389H probably damaging Het
Sec24b C A 3: 130,040,895 G82V probably damaging Het
Sema4a A G 3: 88,449,986 probably null Het
Slc25a11 A T 11: 70,645,535 W149R probably damaging Het
Slc2a7 T G 4: 150,160,094 S340A probably benign Het
Slc32a1 T A 2: 158,614,796 M457K probably damaging Het
Spint4 C T 2: 164,700,892 T135M probably damaging Het
Sult2a2 A C 7: 13,738,303 N142H probably damaging Het
Tbc1d1 G A 5: 64,333,395 G863D probably damaging Het
Tmem156 G A 5: 65,075,574 T151M probably benign Het
Trip12 T C 1: 84,768,680 Q459R probably damaging Het
Vmn2r116 G A 17: 23,386,121 C136Y probably damaging Het
Vmn2r51 C T 7: 10,102,618 V79M possibly damaging Het
Vmn2r67 A T 7: 85,151,815 D304E probably benign Het
Wdr93 T A 7: 79,750,031 F123I probably damaging Het
Zfp672 A T 11: 58,316,630 C288* probably null Het
Zp1 T C 19: 10,919,405 Y90C probably damaging Het
Other mutations in 1700011I03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:1700011I03Rik APN 18 57594086 missense probably damaging 0.98
IGL01646:1700011I03Rik APN 18 57667345 nonsense probably null
R0115:1700011I03Rik UTSW 18 57594142 splice site probably benign
R0285:1700011I03Rik UTSW 18 57533865 missense probably damaging 0.99
R1087:1700011I03Rik UTSW 18 57730798 missense probably damaging 0.96
R1923:1700011I03Rik UTSW 18 57533887 missense probably damaging 0.99
R4927:1700011I03Rik UTSW 18 57730816 nonsense probably null
R5133:1700011I03Rik UTSW 18 57563969 missense possibly damaging 0.92
R5508:1700011I03Rik UTSW 18 57538084 splice site probably null
R5509:1700011I03Rik UTSW 18 57538084 splice site probably null
R5511:1700011I03Rik UTSW 18 57538084 splice site probably null
R6629:1700011I03Rik UTSW 18 57730780 missense possibly damaging 0.53
X0021:1700011I03Rik UTSW 18 57594125 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCTATTCAATGTGAGATCTCTCCC -3'
(R):5'- AATGTGACATCCATGACGGG -3'

Sequencing Primer
(F):5'- CCCTCTCTGTATGTACGAATGTGAG -3'
(R):5'- TGGGGAAGGCTACACACTATATCAC -3'
Posted On2016-10-05