Incidental Mutation 'R5511:1700011I03Rik'
List |< first << previous [record 35 of 19097] next >> last >|
ID431259
Institutional Source Beutler Lab
Gene Symbol 1700011I03Rik
Ensembl Gene ENSMUSG00000058925
Gene NameRIKEN cDNA 1700011I03 gene
Synonyms
MMRRC Submission 043072-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R5511 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location57533780-57731065 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 57538084 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079738] [ENSMUST00000135806]
Predicted Effect probably null
Transcript: ENSMUST00000079738
SMART Domains Protein: ENSMUSP00000078674
Gene: ENSMUSG00000058925

DomainStartEndE-ValueType
coiled coil region 68 177 N/A INTRINSIC
coiled coil region 220 260 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000127130
SMART Domains Protein: ENSMUSP00000117563
Gene: ENSMUSG00000058925

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133147
Predicted Effect probably null
Transcript: ENSMUST00000135806
SMART Domains Protein: ENSMUSP00000115752
Gene: ENSMUSG00000058925

DomainStartEndE-ValueType
coiled coil region 68 151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150186
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153122
Meta Mutation Damage Score 0.6156 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.1%
  • 20x: 90.3%
Validation Efficiency 98% (81/83)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A T 3: 116,788,560 V271D possibly damaging Het
Alox15 G T 11: 70,349,982 P191T probably benign Het
Apaf1 T C 10: 91,054,392 Y583C probably damaging Het
Aqp9 T A 9: 71,163,093 probably benign Het
Bms1 A G 6: 118,388,887 F1113L possibly damaging Het
Cap1 A C 4: 122,862,790 probably benign Het
Car11 T C 7: 45,700,461 W35R probably damaging Het
Casc3 T A 11: 98,810,914 Y91* probably null Het
Cd22 A T 7: 30,870,071 I540N probably damaging Het
Chad A T 11: 94,565,246 E50V probably damaging Het
Chd3 C G 11: 69,361,475 G34R probably damaging Het
Col9a1 T C 1: 24,179,538 V77A unknown Het
Copg1 G A 6: 87,912,294 V873M probably damaging Het
Dnhd1 T A 7: 105,714,156 V3975E probably damaging Het
Dock6 A T 9: 21,817,407 V1290D possibly damaging Het
Elp2 A T 18: 24,612,450 K150* probably null Het
Eri3 A C 4: 117,615,189 Y260S possibly damaging Het
Esrrg C T 1: 188,211,107 L426F probably damaging Het
Farp1 G T 14: 121,237,172 V266L probably damaging Het
Flnc A G 6: 29,458,898 E2459G probably damaging Het
Glis1 G A 4: 107,435,877 D66N probably damaging Het
Gm14129 T A 2: 148,931,526 noncoding transcript Het
Gm28051 A G 12: 102,720,156 *82R probably null Het
Gm5538 T C 3: 59,747,264 L173P probably damaging Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Gne C T 4: 44,041,843 V485M probably damaging Het
Lcn10 T A 2: 25,682,829 V15E probably benign Het
Mapk11 T A 15: 89,145,177 probably null Het
Me3 T G 7: 89,806,668 Y243D probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Myo1h T A 5: 114,345,897 L519* probably null Het
Myo9a T C 9: 59,780,212 V200A probably damaging Het
Mzf1 T A 7: 13,051,599 Q161H possibly damaging Het
Nim1k T G 13: 119,727,594 H93P probably damaging Het
Nkx6-1 C A 5: 101,663,666 R190L probably damaging Het
Noc3l A G 19: 38,794,181 V671A probably benign Het
Nsd1 T C 13: 55,312,730 S2257P probably benign Het
Nup210 T A 6: 91,026,963 I648F probably damaging Het
Olfr1477 T C 19: 13,503,192 M283T probably benign Het
Oplah T C 15: 76,305,744 E223G possibly damaging Het
Plekhs1 A C 19: 56,485,792 T457P probably damaging Het
Plppr4 G A 3: 117,325,902 T286I probably benign Het
Prpf4b T C 13: 34,884,054 probably benign Het
Prss39 T A 1: 34,502,797 D318E possibly damaging Het
Psap A G 10: 60,299,180 E289G possibly damaging Het
Rad17 A G 13: 100,627,649 V438A possibly damaging Het
Raf1 T C 6: 115,620,256 S28G probably benign Het
Ranbp2 A G 10: 58,493,739 D2978G probably benign Het
Rnf170 T A 8: 26,140,999 D213E probably damaging Het
Rsph3a T A 17: 7,946,073 H88Q possibly damaging Het
Scd1 A G 19: 44,406,759 I9T probably benign Het
Sgk3 T C 1: 9,898,686 probably benign Het
Slc14a1 C T 18: 78,102,471 S416N probably benign Het
Smok4a T C 17: 13,526,212 noncoding transcript Het
Sostdc1 A T 12: 36,317,166 I114F probably damaging Het
Spen G T 4: 141,516,838 D295E unknown Het
Spen G A 4: 141,475,064 T2084I possibly damaging Het
Sptbn5 T C 2: 120,059,721 probably benign Het
Srebf1 T C 11: 60,210,358 probably benign Het
Tcea3 A T 4: 136,271,372 Y319F probably damaging Het
Timd4 T A 11: 46,819,980 probably null Het
Tmem88b G A 4: 155,785,545 P20S probably damaging Het
Tsen2 T A 6: 115,561,404 C281S probably damaging Het
Vmn2r28 T C 7: 5,484,012 T551A possibly damaging Het
Vmn2r45 T C 7: 8,471,833 H732R probably benign Het
Wdr90 A G 17: 25,845,021 probably benign Het
Zdbf2 T C 1: 63,305,677 S1072P probably benign Het
Zfp148 A G 16: 33,434,634 probably benign Het
Zfp2 T A 11: 50,900,024 E397D probably damaging Het
Zfp729b A G 13: 67,592,380 F599L probably damaging Het
Other mutations in 1700011I03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:1700011I03Rik APN 18 57594086 missense probably damaging 0.98
IGL01646:1700011I03Rik APN 18 57667345 nonsense probably null
R0115:1700011I03Rik UTSW 18 57594142 splice site probably benign
R0285:1700011I03Rik UTSW 18 57533865 missense probably damaging 0.99
R1087:1700011I03Rik UTSW 18 57730798 missense probably damaging 0.96
R1923:1700011I03Rik UTSW 18 57533887 missense probably damaging 0.99
R4927:1700011I03Rik UTSW 18 57730816 nonsense probably null
R5133:1700011I03Rik UTSW 18 57563969 missense possibly damaging 0.92
R5508:1700011I03Rik UTSW 18 57538084 splice site probably null
R5509:1700011I03Rik UTSW 18 57538084 splice site probably null
R5510:1700011I03Rik UTSW 18 57538084 splice site probably null
R6629:1700011I03Rik UTSW 18 57730780 missense possibly damaging 0.53
X0021:1700011I03Rik UTSW 18 57594125 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCTATTCAATGTGAGATCTCTCCC -3'
(R):5'- CAATGTGACATCCATGACGGG -3'

Sequencing Primer
(F):5'- CCCTCTCTGTATGTACGAATGTGAG -3'
(R):5'- TGGGGAAGGCTACACACTATATCAC -3'
Posted On2016-10-05