Incidental Mutation 'R5511:Slc14a1'
ID431260
Institutional Source Beutler Lab
Gene Symbol Slc14a1
Ensembl Gene ENSMUSG00000059336
Gene Namesolute carrier family 14 (urea transporter), member 1
SynonymsUT-B, 2610507K20Rik, 3021401A05Rik
MMRRC Submission 043072-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5511 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location78100091-78142119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78102471 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 416 (S416N)
Ref Sequence ENSEMBL: ENSMUSP00000125114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091813] [ENSMUST00000160292] [ENSMUST00000160639]
Predicted Effect probably benign
Transcript: ENSMUST00000091813
AA Change: S360N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000089421
Gene: ENSMUSG00000059336
AA Change: S360N

DomainStartEndE-ValueType
Pfam:UT 52 356 1.6e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160292
AA Change: S416N

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000125114
Gene: ENSMUSG00000059336
AA Change: S416N

DomainStartEndE-ValueType
Pfam:UT 110 405 6.3e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160639
AA Change: S360N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000125367
Gene: ENSMUSG00000059336
AA Change: S360N

DomainStartEndE-ValueType
Pfam:UT 52 356 1.6e-120 PFAM
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.1%
  • 20x: 90.3%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane transporter that mediates urea transport in erythrocytes. This gene forms the basis for the Kidd blood group system. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display a grossly normal phenotype although they have an inability to concentrate urea in urine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
Agl A T 3: 116,788,560 V271D possibly damaging Het
Alox15 G T 11: 70,349,982 P191T probably benign Het
Apaf1 T C 10: 91,054,392 Y583C probably damaging Het
Aqp9 T A 9: 71,163,093 probably benign Het
Bms1 A G 6: 118,388,887 F1113L possibly damaging Het
Cap1 A C 4: 122,862,790 probably benign Het
Car11 T C 7: 45,700,461 W35R probably damaging Het
Casc3 T A 11: 98,810,914 Y91* probably null Het
Cd22 A T 7: 30,870,071 I540N probably damaging Het
Chad A T 11: 94,565,246 E50V probably damaging Het
Chd3 C G 11: 69,361,475 G34R probably damaging Het
Col9a1 T C 1: 24,179,538 V77A unknown Het
Copg1 G A 6: 87,912,294 V873M probably damaging Het
Dnhd1 T A 7: 105,714,156 V3975E probably damaging Het
Dock6 A T 9: 21,817,407 V1290D possibly damaging Het
Elp2 A T 18: 24,612,450 K150* probably null Het
Eri3 A C 4: 117,615,189 Y260S possibly damaging Het
Esrrg C T 1: 188,211,107 L426F probably damaging Het
Farp1 G T 14: 121,237,172 V266L probably damaging Het
Flnc A G 6: 29,458,898 E2459G probably damaging Het
Glis1 G A 4: 107,435,877 D66N probably damaging Het
Gm14129 T A 2: 148,931,526 noncoding transcript Het
Gm28051 A G 12: 102,720,156 *82R probably null Het
Gm5538 T C 3: 59,747,264 L173P probably damaging Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Gne C T 4: 44,041,843 V485M probably damaging Het
Lcn10 T A 2: 25,682,829 V15E probably benign Het
Mapk11 T A 15: 89,145,177 probably null Het
Me3 T G 7: 89,806,668 Y243D probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Myo1h T A 5: 114,345,897 L519* probably null Het
Myo9a T C 9: 59,780,212 V200A probably damaging Het
Mzf1 T A 7: 13,051,599 Q161H possibly damaging Het
Nim1k T G 13: 119,727,594 H93P probably damaging Het
Nkx6-1 C A 5: 101,663,666 R190L probably damaging Het
Noc3l A G 19: 38,794,181 V671A probably benign Het
Nsd1 T C 13: 55,312,730 S2257P probably benign Het
Nup210 T A 6: 91,026,963 I648F probably damaging Het
Olfr1477 T C 19: 13,503,192 M283T probably benign Het
Oplah T C 15: 76,305,744 E223G possibly damaging Het
Plekhs1 A C 19: 56,485,792 T457P probably damaging Het
Plppr4 G A 3: 117,325,902 T286I probably benign Het
Prpf4b T C 13: 34,884,054 probably benign Het
Prss39 T A 1: 34,502,797 D318E possibly damaging Het
Psap A G 10: 60,299,180 E289G possibly damaging Het
Rad17 A G 13: 100,627,649 V438A possibly damaging Het
Raf1 T C 6: 115,620,256 S28G probably benign Het
Ranbp2 A G 10: 58,493,739 D2978G probably benign Het
Rnf170 T A 8: 26,140,999 D213E probably damaging Het
Rsph3a T A 17: 7,946,073 H88Q possibly damaging Het
Scd1 A G 19: 44,406,759 I9T probably benign Het
Sgk3 T C 1: 9,898,686 probably benign Het
Smok4a T C 17: 13,526,212 noncoding transcript Het
Sostdc1 A T 12: 36,317,166 I114F probably damaging Het
Spen G T 4: 141,516,838 D295E unknown Het
Spen G A 4: 141,475,064 T2084I possibly damaging Het
Sptbn5 T C 2: 120,059,721 probably benign Het
Srebf1 T C 11: 60,210,358 probably benign Het
Tcea3 A T 4: 136,271,372 Y319F probably damaging Het
Timd4 T A 11: 46,819,980 probably null Het
Tmem88b G A 4: 155,785,545 P20S probably damaging Het
Tsen2 T A 6: 115,561,404 C281S probably damaging Het
Vmn2r28 T C 7: 5,484,012 T551A possibly damaging Het
Vmn2r45 T C 7: 8,471,833 H732R probably benign Het
Wdr90 A G 17: 25,845,021 probably benign Het
Zdbf2 T C 1: 63,305,677 S1072P probably benign Het
Zfp148 A G 16: 33,434,634 probably benign Het
Zfp2 T A 11: 50,900,024 E397D probably damaging Het
Zfp729b A G 13: 67,592,380 F599L probably damaging Het
Other mutations in Slc14a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Slc14a1 APN 18 78104073 missense probably damaging 1.00
Glen_eyrie UTSW 18 78110058 critical splice acceptor site probably null
R1726:Slc14a1 UTSW 18 78116466 missense probably benign 0.21
R1889:Slc14a1 UTSW 18 78109697 missense possibly damaging 0.95
R1895:Slc14a1 UTSW 18 78109697 missense possibly damaging 0.95
R3946:Slc14a1 UTSW 18 78111392 missense probably benign 0.00
R4066:Slc14a1 UTSW 18 78111377 missense probably damaging 0.99
R5763:Slc14a1 UTSW 18 78116414 missense probably benign 0.33
R6228:Slc14a1 UTSW 18 78116399 missense probably damaging 1.00
R6294:Slc14a1 UTSW 18 78110058 critical splice acceptor site probably null
R7157:Slc14a1 UTSW 18 78102411 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTATGGAAGTGGCTCCCAGAG -3'
(R):5'- TCCCAACCAATCATCTTCTGGG -3'

Sequencing Primer
(F):5'- CTCCCAGAGAAGAAAAGCAATTGTG -3'
(R):5'- TCTGTTTGGCCACACTAC -3'
Posted On2016-10-05