Incidental Mutation 'R5517:Olfr1302'
ID431324
Institutional Source Beutler Lab
Gene Symbol Olfr1302
Ensembl Gene ENSMUSG00000044560
Gene Nameolfactory receptor 1302
SynonymsMOR248-3, GA_x6K02T2Q125-72831562-72832500
MMRRC Submission 043076-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5517 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111777429-111782700 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 111780459 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 46 (M46I)
Ref Sequence ENSEMBL: ENSMUSP00000150896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054004] [ENSMUST00000119566] [ENSMUST00000214708] [ENSMUST00000215244]
Predicted Effect probably benign
Transcript: ENSMUST00000054004
AA Change: M49I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061674
Gene: ENSMUSG00000044560
AA Change: M49I

DomainStartEndE-ValueType
Pfam:7tm_4 34 308 2.4e-49 PFAM
Pfam:7tm_1 44 290 8.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119566
AA Change: M46I
Predicted Effect probably benign
Transcript: ENSMUST00000214708
AA Change: M46I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215244
AA Change: M46I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.5%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 C T 17: 35,958,341 R675K possibly damaging Het
Aire A T 10: 78,039,691 S282T probably benign Het
Ak9 A G 10: 41,340,891 E283G probably benign Het
Akap2 T C 4: 57,855,987 Y439H probably damaging Het
Akap9 T A 5: 4,001,665 D1477E possibly damaging Het
Ap2a1 T C 7: 44,906,981 D273G possibly damaging Het
Apob T C 12: 7,990,906 L664P probably damaging Het
Arhgap35 A T 7: 16,563,489 F550L probably damaging Het
Armc2 T C 10: 41,963,850 E373G probably benign Het
Atp8b2 C A 3: 89,946,031 A726S probably benign Het
C030048H21Rik T A 2: 26,255,887 Q87L probably damaging Het
Cd244 T A 1: 171,577,974 probably benign Het
Cdk10 T A 8: 123,230,587 probably null Het
Cenpe C A 3: 135,223,265 P310Q probably damaging Het
Chuk T A 19: 44,097,533 probably null Het
Crebl2 T C 6: 134,851,176 S104P probably benign Het
Ddo A G 10: 40,647,730 K239E probably benign Het
Defb5 A G 8: 19,250,852 probably null Het
Dhx35 T A 2: 158,834,912 M422K probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gatm G A 2: 122,595,543 T409I probably damaging Het
Gdpd1 A T 11: 87,059,506 D80E probably damaging Het
Gspt1 C A 16: 11,253,979 G7C unknown Het
Hells G A 19: 38,954,800 S516N probably benign Het
Ints1 A G 5: 139,752,787 S2069P possibly damaging Het
Kank4 G A 4: 98,774,881 T690M probably damaging Het
Kcnq4 T C 4: 120,715,809 N265S possibly damaging Het
Kif5b C A 18: 6,220,954 A385S probably benign Het
Map2 T C 1: 66,415,256 S1102P probably benign Het
Mcm7 A G 5: 138,164,871 S340P possibly damaging Het
Mcrs1 C T 15: 99,246,995 R246H possibly damaging Het
Myo16 T A 8: 10,560,226 M1189K probably benign Het
Olfr463 A T 11: 87,893,066 I286N probably damaging Het
Olfr847 G A 9: 19,375,767 T38I probably damaging Het
Otog A G 7: 46,274,571 N1118S probably damaging Het
Pcdhb7 G T 18: 37,341,793 probably benign Het
Picalm C T 7: 90,170,598 T189I possibly damaging Het
Ptx4 T A 17: 25,124,786 S337T possibly damaging Het
Rad51ap2 C T 12: 11,458,312 S745L probably benign Het
Rspry1 G A 8: 94,636,760 probably null Het
Scn5a T G 9: 119,495,713 I1350L probably damaging Het
Sgk2 T C 2: 162,997,835 L121P probably damaging Het
Slc17a1 A T 13: 23,872,592 probably benign Het
Slc6a12 A G 6: 121,354,339 N183S probably benign Het
Smg9 C A 7: 24,414,913 probably benign Het
Spred1 G A 2: 117,177,714 S367N probably damaging Het
Srpr T C 9: 35,211,350 V21A probably benign Het
Taar2 A T 10: 23,940,729 I56F possibly damaging Het
Taf1a T G 1: 183,395,985 L67R probably damaging Het
Tbc1d10b C A 7: 127,198,607 R787S possibly damaging Het
Topbp1 T A 9: 103,336,114 N1044K probably benign Het
Usp24 A G 4: 106,375,674 T886A probably benign Het
Vmn2r26 A G 6: 124,050,717 D472G probably damaging Het
Zyg11a T C 4: 108,204,746 N286S possibly damaging Het
Other mutations in Olfr1302
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01354:Olfr1302 APN 2 111780901 missense possibly damaging 0.80
IGL01604:Olfr1302 APN 2 111780590 missense possibly damaging 0.60
IGL02959:Olfr1302 APN 2 111780610 missense probably damaging 1.00
IGL02975:Olfr1302 APN 2 111780921 nonsense probably null
IGL03357:Olfr1302 APN 2 111780526 missense probably benign 0.01
R0245:Olfr1302 UTSW 2 111780335 missense probably damaging 1.00
R1522:Olfr1302 UTSW 2 111780348 synonymous probably null
R2126:Olfr1302 UTSW 2 111780496 missense probably damaging 0.99
R2432:Olfr1302 UTSW 2 111780671 missense probably benign 0.01
R4780:Olfr1302 UTSW 2 111780845 missense probably damaging 1.00
R5260:Olfr1302 UTSW 2 111781181 missense probably damaging 1.00
R6273:Olfr1302 UTSW 2 111781222 missense probably benign 0.00
R7315:Olfr1302 UTSW 2 111780659 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCTGAAGGTTGTTTCTGAAGACAC -3'
(R):5'- GCCACATAACGGTCATATGCC -3'

Sequencing Primer
(F):5'- AGGTTGTTTCTGAAGACACATGAG -3'
(R):5'- TCTCCTGCAGCAATGCAATGAG -3'
Posted On2016-10-05