Incidental Mutation 'R5518:Ttc28'
ID431392
Institutional Source Beutler Lab
Gene Symbol Ttc28
Ensembl Gene ENSMUSG00000033209
Gene Nametetratricopeptide repeat domain 28
Synonyms
MMRRC Submission 043077-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.602) question?
Stock #R5518 (G1)
Quality Score125
Status Validated
Chromosome5
Chromosomal Location110879803-111289780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111225928 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1046 (T1046S)
Ref Sequence ENSEMBL: ENSMUSP00000137609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040111] [ENSMUST00000156290]
Predicted Effect probably benign
Transcript: ENSMUST00000040111
AA Change: T1077S

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000136116
Gene: ENSMUSG00000033209
AA Change: T1077S

DomainStartEndE-ValueType
low complexity region 4 28 N/A INTRINSIC
TPR 52 85 2.84e1 SMART
TPR 86 119 5.03e-1 SMART
TPR 120 153 2.11e-3 SMART
TPR 268 301 8.51e0 SMART
TPR 339 372 1.78e-1 SMART
TPR 379 412 2.82e-4 SMART
TPR 419 452 9.98e-5 SMART
TPR 459 492 1.88e0 SMART
TPR 499 532 1.11e1 SMART
TPR 539 572 2.93e-2 SMART
TPR 579 612 1.21e-3 SMART
TPR 619 652 4.91e-4 SMART
TPR 659 692 7.56e-5 SMART
TPR 699 732 8.29e0 SMART
TPR 739 772 1.63e0 SMART
TPR 779 812 1.24e0 SMART
TPR 819 852 7.98e-4 SMART
TPR 859 892 8.74e0 SMART
TPR 902 935 5.43e-6 SMART
TPR 942 975 4.09e-1 SMART
TPR 982 1015 9.98e-5 SMART
TPR 1022 1055 7.12e-1 SMART
TPR 1062 1095 5.69e0 SMART
TPR 1102 1135 3.14e-2 SMART
TPR 1142 1175 2.84e1 SMART
low complexity region 1259 1277 N/A INTRINSIC
Pfam:CHAT 1415 1738 7.3e-77 PFAM
low complexity region 1972 1990 N/A INTRINSIC
low complexity region 2014 2031 N/A INTRINSIC
low complexity region 2033 2045 N/A INTRINSIC
low complexity region 2155 2171 N/A INTRINSIC
low complexity region 2283 2293 N/A INTRINSIC
low complexity region 2327 2352 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125470
Predicted Effect probably benign
Transcript: ENSMUST00000156290
AA Change: T1046S

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000137609
Gene: ENSMUSG00000033209
AA Change: T1046S

DomainStartEndE-ValueType
low complexity region 4 28 N/A INTRINSIC
TPR 52 85 2.84e1 SMART
TPR 86 119 5.03e-1 SMART
TPR 120 153 2.11e-3 SMART
TPR 268 301 8.51e0 SMART
TPR 308 341 1.78e-1 SMART
TPR 348 381 2.82e-4 SMART
TPR 388 421 9.98e-5 SMART
TPR 428 461 1.88e0 SMART
TPR 468 501 1.11e1 SMART
TPR 508 541 2.93e-2 SMART
TPR 548 581 1.21e-3 SMART
TPR 588 621 4.91e-4 SMART
TPR 628 661 7.56e-5 SMART
TPR 668 701 8.29e0 SMART
TPR 708 741 1.63e0 SMART
TPR 748 781 1.24e0 SMART
TPR 788 821 7.98e-4 SMART
TPR 828 861 8.74e0 SMART
TPR 871 904 5.43e-6 SMART
TPR 911 944 4.09e-1 SMART
TPR 951 984 9.98e-5 SMART
TPR 991 1024 7.12e-1 SMART
TPR 1031 1064 5.69e0 SMART
TPR 1071 1104 3.14e-2 SMART
TPR 1111 1144 2.84e1 SMART
low complexity region 1228 1246 N/A INTRINSIC
Pfam:CHAT 1384 1707 1.1e-76 PFAM
low complexity region 1941 1959 N/A INTRINSIC
low complexity region 1983 2000 N/A INTRINSIC
low complexity region 2002 2014 N/A INTRINSIC
low complexity region 2124 2140 N/A INTRINSIC
low complexity region 2252 2262 N/A INTRINSIC
low complexity region 2296 2321 N/A INTRINSIC
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 94.2%
  • 20x: 86.3%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 C T 7: 46,120,449 E881K probably benign Het
Abcf1 C T 17: 35,958,341 R675K possibly damaging Het
Abl1 T A 2: 31,790,742 C349S probably damaging Het
Acot11 C A 4: 106,750,010 V459L probably benign Het
Ank2 A T 3: 126,959,699 V311D probably damaging Het
Ankrd11 C G 8: 122,890,994 E2040Q possibly damaging Het
Ankrd26 T C 6: 118,548,908 I359V probably benign Het
Armc3 T G 2: 19,297,928 L684V probably benign Het
Asb10 G A 5: 24,539,645 P184S probably damaging Het
Atp10b T C 11: 43,151,636 S8P possibly damaging Het
Blk G T 14: 63,378,507 S324R possibly damaging Het
C4b G C 17: 34,734,442 N1022K probably benign Het
Card6 G T 15: 5,105,214 T169K probably damaging Het
Catsper2 T C 2: 121,406,363 T268A possibly damaging Het
Cbx3 C T 6: 51,481,746 P64S probably benign Het
Chchd6 A G 6: 89,567,585 probably null Het
Cntn1 G A 15: 92,314,653 E899K probably benign Het
Col6a4 A T 9: 106,072,188 S749R possibly damaging Het
Cpne3 T G 4: 19,553,779 N84T probably benign Het
Dcxr A C 11: 120,726,199 probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Emsy T C 7: 98,593,611 Q1107R possibly damaging Het
Erbb2 G T 11: 98,422,770 C221F probably damaging Het
Exoc3l T C 8: 105,293,163 N353D probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
G3bp2 T A 5: 92,068,488 H63L probably benign Het
Galnt17 A G 5: 130,900,590 Y460H probably damaging Het
Gm6003 T A 7: 33,165,579 noncoding transcript Het
Gm884 A T 11: 103,615,253 I1963K probably benign Het
Ighv5-12-4 A G 12: 113,762,534 L23P probably damaging Het
Ins1 T C 19: 52,264,739 L39P probably damaging Het
Itpr3 T G 17: 27,087,592 V210G probably damaging Het
Klrb1 T A 6: 128,706,525 T210S probably benign Het
Krtap24-1 A T 16: 88,611,708 F177I probably damaging Het
Mcat A G 15: 83,547,674 probably null Het
Mknk2 A T 10: 80,668,641 C229S possibly damaging Het
Mta2 C A 19: 8,948,092 Q362K probably benign Het
Ndst4 T C 3: 125,438,456 Y225H probably benign Het
Olfr1423 T C 19: 12,036,065 R226G probably damaging Het
Pcdha1 A G 18: 36,932,362 D693G probably benign Het
Pik3r5 G A 11: 68,477,468 D100N possibly damaging Het
Pld3 T C 7: 27,532,371 D465G probably damaging Het
Prkdc T C 16: 15,678,308 Y788H probably damaging Het
Ptprt T A 2: 162,278,223 D108V probably damaging Het
Rasgrp3 T A 17: 75,516,359 M475K probably benign Het
Rbak A G 5: 143,173,309 L663P probably damaging Het
Rnf17 A G 14: 56,482,133 N947D probably damaging Het
Ryr2 T C 13: 11,687,909 S2898G probably benign Het
Serpina1e A C 12: 103,950,828 L194R probably damaging Het
Smg6 T C 11: 75,053,898 S158P probably damaging Het
Smtnl2 A T 11: 72,401,516 V269E possibly damaging Het
Snx14 G T 9: 88,383,802 P760Q probably damaging Het
Sorl1 T C 9: 42,037,212 E759G possibly damaging Het
Sspo C T 6: 48,496,654 T4906M possibly damaging Het
Syne2 T A 12: 75,945,170 F1970I possibly damaging Het
Tekt3 C A 11: 63,083,942 H362Q probably benign Het
Tmem121 T C 12: 113,188,927 V255A possibly damaging Het
Tmem201 T C 4: 149,718,077 T614A probably benign Het
Tnc T C 4: 64,017,679 D340G probably damaging Het
Ubxn2a T C 12: 4,902,238 D8G probably benign Het
Vwde T C 6: 13,186,938 N850S probably benign Het
Zfp280d A G 9: 72,324,135 H451R probably damaging Het
Zfp462 T C 4: 55,009,818 C595R probably damaging Het
Zfp768 A G 7: 127,344,411 S182P probably benign Het
Other mutations in Ttc28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Ttc28 APN 5 111225688 missense probably damaging 1.00
IGL00963:Ttc28 APN 5 111286389 nonsense probably null
IGL00969:Ttc28 APN 5 111225740 missense probably benign 0.00
IGL01366:Ttc28 APN 5 111085171 critical splice donor site probably null
IGL01528:Ttc28 APN 5 111101960 splice site probably benign
IGL01558:Ttc28 APN 5 111283962 missense probably damaging 0.99
IGL01973:Ttc28 APN 5 111224235 missense possibly damaging 0.88
IGL02040:Ttc28 APN 5 110892936 nonsense probably null
IGL02432:Ttc28 APN 5 111223235 missense probably damaging 1.00
IGL02531:Ttc28 APN 5 111225850 missense probably damaging 1.00
IGL02819:Ttc28 APN 5 111266583 missense probably benign
IGL02830:Ttc28 APN 5 111286239 missense probably benign 0.10
IGL02893:Ttc28 APN 5 111285385 missense possibly damaging 0.87
IGL03387:Ttc28 APN 5 111233342 missense probably benign 0.07
PIT4131001:Ttc28 UTSW 5 110892853 missense probably benign 0.00
R0142:Ttc28 UTSW 5 111277457 missense probably benign 0.40
R0166:Ttc28 UTSW 5 111225634 missense probably benign 0.01
R0328:Ttc28 UTSW 5 111284067 splice site probably benign
R0582:Ttc28 UTSW 5 111183296 missense probably damaging 1.00
R0744:Ttc28 UTSW 5 111231081 missense probably damaging 1.00
R0811:Ttc28 UTSW 5 111235500 missense probably benign 0.24
R0812:Ttc28 UTSW 5 111235500 missense probably benign 0.24
R0828:Ttc28 UTSW 5 111223446 missense probably damaging 1.00
R0833:Ttc28 UTSW 5 111231081 missense probably damaging 1.00
R1013:Ttc28 UTSW 5 111276965 missense probably benign 0.01
R1168:Ttc28 UTSW 5 111231111 missense probably damaging 1.00
R1194:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1195:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1195:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1195:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1196:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1205:Ttc28 UTSW 5 111285769 missense probably benign 0.04
R1386:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1467:Ttc28 UTSW 5 111285388 missense probably benign 0.00
R1467:Ttc28 UTSW 5 111285388 missense probably benign 0.00
R1537:Ttc28 UTSW 5 111285318 missense probably damaging 0.96
R1539:Ttc28 UTSW 5 111100811 missense possibly damaging 0.77
R1558:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1560:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1561:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1566:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1768:Ttc28 UTSW 5 111277168 missense possibly damaging 0.77
R1775:Ttc28 UTSW 5 111276811 missense probably benign 0.00
R1909:Ttc28 UTSW 5 111284054 critical splice donor site probably null
R1911:Ttc28 UTSW 5 111280750 missense possibly damaging 0.93
R1970:Ttc28 UTSW 5 111235635 missense probably benign 0.00
R1990:Ttc28 UTSW 5 111276322 missense probably benign 0.37
R1992:Ttc28 UTSW 5 111276322 missense probably benign 0.37
R2066:Ttc28 UTSW 5 111225933 missense probably benign 0.01
R2112:Ttc28 UTSW 5 111276273 missense probably damaging 0.99
R2158:Ttc28 UTSW 5 111177617 intron probably benign
R2192:Ttc28 UTSW 5 111223496 missense probably damaging 0.99
R2267:Ttc28 UTSW 5 111226003 missense possibly damaging 0.75
R2384:Ttc28 UTSW 5 111276208 missense possibly damaging 0.95
R2989:Ttc28 UTSW 5 111224015 missense probably benign 0.29
R3881:Ttc28 UTSW 5 111183240 missense probably damaging 1.00
R3919:Ttc28 UTSW 5 111285379 missense possibly damaging 0.80
R4455:Ttc28 UTSW 5 111224058 frame shift probably null
R4456:Ttc28 UTSW 5 111224058 frame shift probably null
R4522:Ttc28 UTSW 5 111280172 missense probably benign 0.01
R4548:Ttc28 UTSW 5 111271224 missense possibly damaging 0.86
R4591:Ttc28 UTSW 5 111223281 missense probably damaging 1.00
R4633:Ttc28 UTSW 5 111224001 missense probably damaging 1.00
R4700:Ttc28 UTSW 5 111277043 missense probably damaging 1.00
R4714:Ttc28 UTSW 5 111285229 missense possibly damaging 0.65
R4790:Ttc28 UTSW 5 111224217 missense possibly damaging 0.94
R4803:Ttc28 UTSW 5 111277463 missense possibly damaging 0.90
R4840:Ttc28 UTSW 5 111286081 missense probably damaging 1.00
R4969:Ttc28 UTSW 5 111276255 missense probably damaging 0.96
R5019:Ttc28 UTSW 5 111102064 missense possibly damaging 0.47
R5130:Ttc28 UTSW 5 110892856 missense probably benign
R5150:Ttc28 UTSW 5 111225689 missense probably damaging 1.00
R5214:Ttc28 UTSW 5 111177623 intron probably benign
R5254:Ttc28 UTSW 5 111271238 missense probably benign 0.01
R5851:Ttc28 UTSW 5 111235469 splice site probably benign
R5931:Ttc28 UTSW 5 111085109 missense possibly damaging 0.81
R6011:Ttc28 UTSW 5 111286443 missense probably benign
R6176:Ttc28 UTSW 5 111223985 missense probably damaging 1.00
R6221:Ttc28 UTSW 5 111271248 missense probably benign 0.00
R6398:Ttc28 UTSW 5 111276276 missense probably damaging 1.00
R6717:Ttc28 UTSW 5 111285436 missense probably benign
R6770:Ttc28 UTSW 5 111286140 missense probably damaging 1.00
R6901:Ttc28 UTSW 5 111277025 missense possibly damaging 0.88
R7038:Ttc28 UTSW 5 111266579 missense probably benign 0.09
R7073:Ttc28 UTSW 5 111223416 missense possibly damaging 0.96
R7101:Ttc28 UTSW 5 111085092 missense probably damaging 1.00
R7135:Ttc28 UTSW 5 111280007 missense probably damaging 1.00
V8831:Ttc28 UTSW 5 111100712 missense probably benign 0.11
Z1088:Ttc28 UTSW 5 111286315 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTACGAGCAAGCCATCTCTTG -3'
(R):5'- GTTGGAGCCCTTTTGCCTAC -3'

Sequencing Primer
(F):5'- TTGAACGCCAGCTGAACATTG -3'
(R):5'- ACCTTCCTGTAAGTACATGACTG -3'
Posted On2016-10-05