Incidental Mutation 'R5518:C4b'
ID431434
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Namecomplement component 4B (Chido blood group)
SynonymsC4, Ss
MMRRC Submission 043077-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5518 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34728380-34743882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 34734442 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1022 (N1022K)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
Predicted Effect probably benign
Transcript: ENSMUST00000069507
AA Change: N1022K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: N1022K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Meta Mutation Damage Score 0.1148 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 94.2%
  • 20x: 86.3%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 C T 7: 46,120,449 E881K probably benign Het
Abcf1 C T 17: 35,958,341 R675K possibly damaging Het
Abl1 T A 2: 31,790,742 C349S probably damaging Het
Acot11 C A 4: 106,750,010 V459L probably benign Het
Ank2 A T 3: 126,959,699 V311D probably damaging Het
Ankrd11 C G 8: 122,890,994 E2040Q possibly damaging Het
Ankrd26 T C 6: 118,548,908 I359V probably benign Het
Armc3 T G 2: 19,297,928 L684V probably benign Het
Asb10 G A 5: 24,539,645 P184S probably damaging Het
Atp10b T C 11: 43,151,636 S8P possibly damaging Het
Blk G T 14: 63,378,507 S324R possibly damaging Het
Card6 G T 15: 5,105,214 T169K probably damaging Het
Catsper2 T C 2: 121,406,363 T268A possibly damaging Het
Cbx3 C T 6: 51,481,746 P64S probably benign Het
Chchd6 A G 6: 89,567,585 probably null Het
Cntn1 G A 15: 92,314,653 E899K probably benign Het
Col6a4 A T 9: 106,072,188 S749R possibly damaging Het
Cpne3 T G 4: 19,553,779 N84T probably benign Het
Dcxr A C 11: 120,726,199 probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Emsy T C 7: 98,593,611 Q1107R possibly damaging Het
Erbb2 G T 11: 98,422,770 C221F probably damaging Het
Exoc3l T C 8: 105,293,163 N353D probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
G3bp2 T A 5: 92,068,488 H63L probably benign Het
Galnt17 A G 5: 130,900,590 Y460H probably damaging Het
Gm6003 T A 7: 33,165,579 noncoding transcript Het
Gm884 A T 11: 103,615,253 I1963K probably benign Het
Ighv5-12-4 A G 12: 113,762,534 L23P probably damaging Het
Ins1 T C 19: 52,264,739 L39P probably damaging Het
Itpr3 T G 17: 27,087,592 V210G probably damaging Het
Klrb1 T A 6: 128,706,525 T210S probably benign Het
Krtap24-1 A T 16: 88,611,708 F177I probably damaging Het
Mcat A G 15: 83,547,674 probably null Het
Mknk2 A T 10: 80,668,641 C229S possibly damaging Het
Mta2 C A 19: 8,948,092 Q362K probably benign Het
Ndst4 T C 3: 125,438,456 Y225H probably benign Het
Olfr1423 T C 19: 12,036,065 R226G probably damaging Het
Pcdha1 A G 18: 36,932,362 D693G probably benign Het
Pik3r5 G A 11: 68,477,468 D100N possibly damaging Het
Pld3 T C 7: 27,532,371 D465G probably damaging Het
Prkdc T C 16: 15,678,308 Y788H probably damaging Het
Ptprt T A 2: 162,278,223 D108V probably damaging Het
Rasgrp3 T A 17: 75,516,359 M475K probably benign Het
Rbak A G 5: 143,173,309 L663P probably damaging Het
Rnf17 A G 14: 56,482,133 N947D probably damaging Het
Ryr2 T C 13: 11,687,909 S2898G probably benign Het
Serpina1e A C 12: 103,950,828 L194R probably damaging Het
Smg6 T C 11: 75,053,898 S158P probably damaging Het
Smtnl2 A T 11: 72,401,516 V269E possibly damaging Het
Snx14 G T 9: 88,383,802 P760Q probably damaging Het
Sorl1 T C 9: 42,037,212 E759G possibly damaging Het
Sspo C T 6: 48,496,654 T4906M possibly damaging Het
Syne2 T A 12: 75,945,170 F1970I possibly damaging Het
Tekt3 C A 11: 63,083,942 H362Q probably benign Het
Tmem121 T C 12: 113,188,927 V255A possibly damaging Het
Tmem201 T C 4: 149,718,077 T614A probably benign Het
Tnc T C 4: 64,017,679 D340G probably damaging Het
Ttc28 A T 5: 111,225,928 T1046S probably benign Het
Ubxn2a T C 12: 4,902,238 D8G probably benign Het
Vwde T C 6: 13,186,938 N850S probably benign Het
Zfp280d A G 9: 72,324,135 H451R probably damaging Het
Zfp462 T C 4: 55,009,818 C595R probably damaging Het
Zfp768 A G 7: 127,344,411 S182P probably benign Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1713:C4b UTSW 17 34729271 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGGTGCCAAGGTTCCTAC -3'
(R):5'- GTGCGTAGACCTAGTCTCATCTTC -3'

Sequencing Primer
(F):5'- TCTCCAGCTGTTTGGGCCAG -3'
(R):5'- GTAGACCTAGTCTCATCTTCAACTTC -3'
Posted On2016-10-05