Incidental Mutation 'R5521:Olfr298'
ID431548
Institutional Source Beutler Lab
Gene Symbol Olfr298
Ensembl Gene ENSMUSG00000062878
Gene Nameolfactory receptor 298
SynonymsGA_x6K02T2NHDJ-9619796-9620794, MOR219-4
MMRRC Submission 043080-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R5521 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86486322-86492484 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86488631 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 307 (C307S)
Ref Sequence ENSEMBL: ENSMUSP00000150228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077800] [ENSMUST00000213223] [ENSMUST00000216968] [ENSMUST00000217110]
Predicted Effect probably benign
Transcript: ENSMUST00000077800
AA Change: C307S

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000076973
Gene: ENSMUSG00000062878
AA Change: C307S

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 4.2e-37 PFAM
Pfam:7tm_1 39 288 8.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213223
AA Change: C307S

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000216968
AA Change: C307S

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000217110
AA Change: C307S

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.1172 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.5%
  • 10x: 94.4%
  • 20x: 87.5%
Validation Efficiency 94% (72/77)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 A G 9: 44,279,683 probably benign Het
Abhd14a G T 9: 106,443,834 D107E probably damaging Het
Acat1 T A 9: 53,583,507 K362* probably null Het
Adad2 T A 8: 119,612,789 S3R probably benign Het
Adcy8 C A 15: 64,815,350 R435M probably damaging Het
Adgrv1 A T 13: 81,419,389 S5222T probably benign Het
Ankk1 A T 9: 49,420,448 M182K probably benign Het
Apba1 C T 19: 23,893,593 P263L probably damaging Het
Arhgap39 G A 15: 76,765,494 S26L possibly damaging Het
Ccng1 G A 11: 40,752,266 T118I possibly damaging Het
Cenpe T C 3: 135,269,065 S2329P probably damaging Het
Chil4 A G 3: 106,203,697 Y294H possibly damaging Het
Chst8 A C 7: 34,675,245 S390A probably benign Het
Dars T C 1: 128,373,973 D308G probably benign Het
Dlec1 A C 9: 119,143,401 Q1458P possibly damaging Het
Dvl2 G A 11: 70,006,407 E312K probably damaging Het
Fchsd1 T C 18: 37,966,484 H219R probably damaging Het
Foxd4 A C 19: 24,899,643 C398G probably damaging Het
Gm10719 T A 9: 3,018,970 F72I probably damaging Het
Gm5414 T C 15: 101,627,987 I68V probably benign Het
Gmip C T 8: 69,817,399 T684I probably damaging Het
Gpr137c T C 14: 45,278,694 I295T possibly damaging Het
Hivep1 T A 13: 42,158,328 M1348K probably damaging Het
Igkv6-23 T C 6: 70,260,613 D48G probably benign Het
Il3 G A 11: 54,267,132 T40M possibly damaging Het
Ing2 T C 8: 47,669,213 E100G probably damaging Het
Itpr3 C A 17: 27,107,334 H1359Q probably benign Het
Lama1 T A 17: 67,780,894 Y1502* probably null Het
Mamdc2 C A 19: 23,310,938 G579W probably damaging Het
Mapk6 G A 9: 75,393,316 probably benign Het
Mapk8ip2 C T 15: 89,458,804 R616W probably damaging Het
Mc5r T A 18: 68,339,677 L369H possibly damaging Het
Meis1 T C 11: 18,988,260 probably benign Het
Mmp8 A G 9: 7,560,643 K107R probably benign Het
Mn1 C T 5: 111,421,769 H1202Y possibly damaging Het
Naip2 A G 13: 100,154,914 L1172P probably damaging Het
Nek9 C T 12: 85,327,445 D273N probably benign Het
Nlrp4e A T 7: 23,321,765 D559V probably benign Het
Nlrp4g T C 9: 124,350,020 noncoding transcript Het
Oit3 G T 10: 59,435,914 A207E probably benign Het
Olfr1140 A G 2: 87,747,062 I289V probably benign Het
Olfr462 A T 11: 87,889,719 M59K probably damaging Het
Olfr71 A T 4: 43,705,788 M260K possibly damaging Het
Pde4c T C 8: 70,747,382 probably null Het
Ppp1r26 A G 2: 28,451,426 E356G probably benign Het
Pramef12 A G 4: 144,395,971 M1T probably null Het
Ptges3-ps T A 6: 85,844,321 noncoding transcript Het
Ptpn13 T G 5: 103,501,428 F232L probably benign Het
Reps1 T C 10: 18,104,234 S114P probably damaging Het
Scarf2 T A 16: 17,803,602 probably null Het
Sdha A T 13: 74,350,099 probably benign Het
Secisbp2l A T 2: 125,752,977 V146D possibly damaging Het
Slc26a8 T A 17: 28,654,859 T385S probably benign Het
Slc4a1 G A 11: 102,353,266 T679M probably benign Het
Tbc1d14 T A 5: 36,520,552 E353V probably damaging Het
Thap2 T A 10: 115,372,760 K152* probably null Het
Thbd A T 2: 148,407,735 I71N probably damaging Het
V1ra8 T A 6: 90,203,054 W80R probably damaging Het
Vmn1r218 A G 13: 23,136,573 Y30C probably benign Het
Vmn2r60 C A 7: 42,195,625 T804K probably damaging Het
Vmn2r68 A T 7: 85,233,718 D275E probably benign Het
Vps13c A G 9: 67,951,439 I2724V probably benign Het
Xrcc5 C A 1: 72,346,271 P507Q probably damaging Het
Zfp120 A T 2: 150,117,579 Y274* probably null Het
Zfp780b C A 7: 27,974,748 probably null Het
Other mutations in Olfr298
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Olfr298 APN 7 86489557 utr 5 prime probably benign
IGL01603:Olfr298 APN 7 86488931 missense possibly damaging 0.92
IGL02389:Olfr298 APN 7 86489128 missense probably damaging 0.98
IGL03146:Olfr298 APN 7 86489194 missense probably damaging 1.00
R0680:Olfr298 UTSW 7 86489337 missense probably benign
R0834:Olfr298 UTSW 7 86489490 missense probably benign 0.11
R1132:Olfr298 UTSW 7 86489217 missense probably benign 0.03
R1519:Olfr298 UTSW 7 86489125 missense probably damaging 0.99
R1881:Olfr298 UTSW 7 86489438 missense probably benign 0.01
R2170:Olfr298 UTSW 7 86488570 missense probably benign 0.03
R4500:Olfr298 UTSW 7 86488919 missense probably benign 0.00
R4524:Olfr298 UTSW 7 86488826 missense probably damaging 1.00
R5184:Olfr298 UTSW 7 86489291 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GAGCCTACTGCAATCAAGGC -3'
(R):5'- AAAGCATTTGCCACCTGCC -3'

Sequencing Primer
(F):5'- TACTGCAATCAAGGCCGGGTG -3'
(R):5'- CAGTGTTTTCATTGTTACAGCTTGC -3'
Posted On2016-10-05