Incidental Mutation 'R5521:Il3'
ID431565
Institutional Source Beutler Lab
Gene Symbol Il3
Ensembl Gene ENSMUSG00000018914
Gene Nameinterleukin 3
SynonymsHCGF, BPA, Il-3, Csfmu, PSF, MCGF
MMRRC Submission 043080-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5521 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location54265303-54267277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 54267132 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 40 (T40M)
Ref Sequence ENSEMBL: ENSMUSP00000019058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019058]
PDB Structure
Solution structure of murine interleukin 3 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019058
AA Change: T40M

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000019058
Gene: ENSMUSG00000018914
AA Change: T40M

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:IL3 27 138 3.8e-41 PFAM
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.5%
  • 10x: 94.4%
  • 20x: 87.5%
Validation Efficiency 94% (72/77)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene show abnormal mast cell development. Contact hypersensitivity is reduced and resistance to parasitic invections is increased. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 A G 9: 44,279,683 probably benign Het
Abhd14a G T 9: 106,443,834 D107E probably damaging Het
Acat1 T A 9: 53,583,507 K362* probably null Het
Adad2 T A 8: 119,612,789 S3R probably benign Het
Adcy8 C A 15: 64,815,350 R435M probably damaging Het
Adgrv1 A T 13: 81,419,389 S5222T probably benign Het
Ankk1 A T 9: 49,420,448 M182K probably benign Het
Apba1 C T 19: 23,893,593 P263L probably damaging Het
Arhgap39 G A 15: 76,765,494 S26L possibly damaging Het
Ccng1 G A 11: 40,752,266 T118I possibly damaging Het
Cenpe T C 3: 135,269,065 S2329P probably damaging Het
Chil4 A G 3: 106,203,697 Y294H possibly damaging Het
Chst8 A C 7: 34,675,245 S390A probably benign Het
Dars T C 1: 128,373,973 D308G probably benign Het
Dlec1 A C 9: 119,143,401 Q1458P possibly damaging Het
Dvl2 G A 11: 70,006,407 E312K probably damaging Het
Fchsd1 T C 18: 37,966,484 H219R probably damaging Het
Foxd4 A C 19: 24,899,643 C398G probably damaging Het
Gm10719 T A 9: 3,018,970 F72I probably damaging Het
Gm5414 T C 15: 101,627,987 I68V probably benign Het
Gmip C T 8: 69,817,399 T684I probably damaging Het
Gpr137c T C 14: 45,278,694 I295T possibly damaging Het
Hivep1 T A 13: 42,158,328 M1348K probably damaging Het
Igkv6-23 T C 6: 70,260,613 D48G probably benign Het
Ing2 T C 8: 47,669,213 E100G probably damaging Het
Itpr3 C A 17: 27,107,334 H1359Q probably benign Het
Lama1 T A 17: 67,780,894 Y1502* probably null Het
Mamdc2 C A 19: 23,310,938 G579W probably damaging Het
Mapk6 G A 9: 75,393,316 probably benign Het
Mapk8ip2 C T 15: 89,458,804 R616W probably damaging Het
Mc5r T A 18: 68,339,677 L369H possibly damaging Het
Meis1 T C 11: 18,988,260 probably benign Het
Mmp8 A G 9: 7,560,643 K107R probably benign Het
Mn1 C T 5: 111,421,769 H1202Y possibly damaging Het
Naip2 A G 13: 100,154,914 L1172P probably damaging Het
Nek9 C T 12: 85,327,445 D273N probably benign Het
Nlrp4e A T 7: 23,321,765 D559V probably benign Het
Nlrp4g T C 9: 124,350,020 noncoding transcript Het
Oit3 G T 10: 59,435,914 A207E probably benign Het
Olfr1140 A G 2: 87,747,062 I289V probably benign Het
Olfr298 A T 7: 86,488,631 C307S probably benign Het
Olfr462 A T 11: 87,889,719 M59K probably damaging Het
Olfr71 A T 4: 43,705,788 M260K possibly damaging Het
Pde4c T C 8: 70,747,382 probably null Het
Ppp1r26 A G 2: 28,451,426 E356G probably benign Het
Pramef12 A G 4: 144,395,971 M1T probably null Het
Ptges3-ps T A 6: 85,844,321 noncoding transcript Het
Ptpn13 T G 5: 103,501,428 F232L probably benign Het
Reps1 T C 10: 18,104,234 S114P probably damaging Het
Scarf2 T A 16: 17,803,602 probably null Het
Sdha A T 13: 74,350,099 probably benign Het
Secisbp2l A T 2: 125,752,977 V146D possibly damaging Het
Slc26a8 T A 17: 28,654,859 T385S probably benign Het
Slc4a1 G A 11: 102,353,266 T679M probably benign Het
Tbc1d14 T A 5: 36,520,552 E353V probably damaging Het
Thap2 T A 10: 115,372,760 K152* probably null Het
Thbd A T 2: 148,407,735 I71N probably damaging Het
V1ra8 T A 6: 90,203,054 W80R probably damaging Het
Vmn1r218 A G 13: 23,136,573 Y30C probably benign Het
Vmn2r60 C A 7: 42,195,625 T804K probably damaging Het
Vmn2r68 A T 7: 85,233,718 D275E probably benign Het
Vps13c A G 9: 67,951,439 I2724V probably benign Het
Xrcc5 C A 1: 72,346,271 P507Q probably damaging Het
Zfp120 A T 2: 150,117,579 Y274* probably null Het
Zfp780b C A 7: 27,974,748 probably null Het
Other mutations in Il3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0123:Il3 UTSW 11 54265680 critical splice donor site probably null
R0134:Il3 UTSW 11 54265680 critical splice donor site probably null
R0225:Il3 UTSW 11 54265680 critical splice donor site probably null
R1242:Il3 UTSW 11 54267103 missense probably benign 0.00
R2425:Il3 UTSW 11 54265549 missense possibly damaging 0.79
R4837:Il3 UTSW 11 54267257 start gained probably benign
R6958:Il3 UTSW 11 54267111 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATAGATGGAACCCAAGAATATCCC -3'
(R):5'- ATAAGGTGAAGGCTCCTGTGG -3'

Sequencing Primer
(F):5'- TCAGAGAGGGTCCTTCATCATCAG -3'
(R):5'- GCTTCTTCAGAACCCCTTGGAG -3'
Posted On2016-10-05