Incidental Mutation 'R5524:Tdrd7'
ID431735
Institutional Source Beutler Lab
Gene Symbol Tdrd7
Ensembl Gene ENSMUSG00000035517
Gene Nametudor domain containing 7
Synonyms5730495N10Rik
MMRRC Submission 043082-MU
Accession Numbers

Genbank: NM_146142; MGI: 2140279

Is this an essential gene? Possibly essential (E-score: 0.694) question?
Stock #R5524 (G1)
Quality Score161
Status Validated
Chromosome4
Chromosomal Location45965334-46034761 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46034301 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1016 (K1016E)
Ref Sequence ENSEMBL: ENSMUSP00000099993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102929] [ENSMUST00000107773] [ENSMUST00000107777] [ENSMUST00000156200]
PDB Structure
NMR structure of the first lotus domain of tudor domain-containing protein 7 [SOLUTION NMR]
NMR structure of the second and third lotus domains of tudor domain-containing protein 7 (NMR ensemble overlay for Lotus #2) [SOLUTION NMR]
NMR structure of the second and third lotus domains of tudor domain-containing protein 7 (NMR ensemble overlay for Lotus #3) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000102929
AA Change: K1016E

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099993
Gene: ENSMUSG00000035517
AA Change: K1016E

DomainStartEndE-ValueType
Pfam:OST-HTH 3 73 2.6e-10 PFAM
internal_repeat_1 223 300 2.94e-9 PROSPERO
low complexity region 302 318 N/A INTRINSIC
internal_repeat_1 326 400 2.94e-9 PROSPERO
TUDOR 500 556 2.08e-5 SMART
TUDOR 690 746 1.66e-4 SMART
TUDOR 945 1001 4.03e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107773
SMART Domains Protein: ENSMUSP00000103402
Gene: ENSMUSG00000028328

DomainStartEndE-ValueType
Pfam:Tropomodulin 3 143 6.3e-64 PFAM
PDB:1IO0|A 160 344 1e-115 PDB
SCOP:d1a4ya_ 181 312 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107777
AA Change: K1049E

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103406
Gene: ENSMUSG00000035517
AA Change: K1049E

DomainStartEndE-ValueType
Pfam:OST-HTH 36 106 5.7e-11 PFAM
internal_repeat_1 256 333 3.1e-9 PROSPERO
low complexity region 335 351 N/A INTRINSIC
internal_repeat_1 359 433 3.1e-9 PROSPERO
TUDOR 533 589 2.08e-5 SMART
TUDOR 723 779 1.66e-4 SMART
TUDOR 978 1034 4.03e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155936
Predicted Effect probably benign
Transcript: ENSMUST00000156200
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Tudor family of proteins. This protein contains conserved Tudor domains and LOTUS domains. It is a component of RNA granules, which function in RNA processing. Mutations in this gene have been associated with cataract formation in mouse and human. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous inactivation of this gene causes arrest of spermatogenesis, male sterility, glaucoma, and cataracts. Aging mice homozygous for an ENU-induced (null) allele show additional ocular phenotypes including an enlarged anterior chamber, lens extrusion, a flat iris, uveitis, and optic neuropathy. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010L04Rik T A 7: 82,853,942 noncoding transcript Het
6030469F06Rik A G 12: 31,184,863 noncoding transcript Het
A830031A19Rik T A 11: 24,058,776 I13F unknown Het
Acsbg2 A C 17: 56,850,197 L309R probably damaging Het
Adam32 A T 8: 24,922,312 M76K probably damaging Het
Adamts14 C A 10: 61,230,443 R297L probably damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Asb14 A G 14: 26,900,451 K80E possibly damaging Het
Baiap2l1 T C 5: 144,280,949 T276A probably benign Het
Cacna1d G A 14: 30,042,129 P2127S probably benign Het
Ces2g A G 8: 104,966,895 T403A probably benign Het
Cgn A C 3: 94,779,989 M1R probably null Het
Chd5 T G 4: 152,376,630 S1226A probably benign Het
Col18a1 A G 10: 77,058,724 V1497A probably damaging Het
Cpd A T 11: 76,797,901 Y848* probably null Het
Cyp2a12 T C 7: 27,031,231 V207A probably benign Het
Cyth1 G A 11: 118,182,767 R247W probably benign Het
Derl3 T C 10: 75,894,490 V129A possibly damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Eml1 A T 12: 108,521,376 I518L probably damaging Het
Eri1 A G 8: 35,478,609 V174A probably benign Het
Fgd3 T A 13: 49,277,577 I435F probably damaging Het
Foxd1 T G 13: 98,355,904 S429A unknown Het
Ftcd T A 10: 76,589,331 probably benign Het
Gm5478 G T 15: 101,644,667 N323K probably benign Het
Gnpda1 G T 18: 38,335,108 P45Q probably damaging Het
Kif20a G T 18: 34,630,625 probably null Het
Klrb1 T C 6: 128,712,333 probably null Het
Lcorl C A 5: 45,775,522 probably null Het
Lcorl T A 5: 45,775,523 probably null Het
Lrp1b T A 2: 41,110,888 K2108M probably damaging Het
Lyst C T 13: 13,746,779 P3437S probably benign Het
Macrod2 A T 2: 142,317,943 M349L possibly damaging Het
March7 T C 2: 60,245,303 probably benign Het
Mcm9 A T 10: 53,548,690 C601* probably null Het
Muc19 G T 15: 91,894,393 noncoding transcript Het
Mycbp2 T C 14: 103,295,237 D427G probably damaging Het
Nap1l5 C A 6: 58,906,778 V64L possibly damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Npas3 T C 12: 54,068,938 V863A possibly damaging Het
Nr2c2 T A 6: 92,139,765 probably null Het
Olfr181 C T 16: 58,925,809 C254Y probably benign Het
Olfr43 A T 11: 74,206,583 L211Q probably damaging Het
Olfr44 C T 9: 39,484,987 V89M probably damaging Het
Oosp3 T C 19: 11,705,430 F56S possibly damaging Het
Plgrkt G A 19: 29,350,450 P78S probably damaging Het
Prss36 G A 7: 127,934,465 Q56* probably null Het
Ptprz1 A G 6: 22,986,318 probably null Het
Qsox2 A T 2: 26,217,687 F265I probably damaging Het
R3hcc1l G T 19: 42,563,868 E435* probably null Het
Shbg T C 11: 69,616,762 D163G probably benign Het
Skint7 T A 4: 111,980,349 L108H probably damaging Het
Smtnl1 T A 2: 84,818,894 E5D probably benign Het
Spock1 C T 13: 57,556,795 G120D probably damaging Het
Stk11ip G T 1: 75,532,327 C700F probably damaging Het
Sult4a1 C T 15: 84,089,958 probably null Het
Syngap1 A G 17: 26,957,152 H138R probably damaging Het
Tmem167b T C 3: 108,560,253 K26E possibly damaging Het
Tnfaip3 A G 10: 19,008,195 S146P probably damaging Het
Ttn C T 2: 76,776,716 V16242I possibly damaging Het
Vmn2r-ps3 T A 3: 64,053,449 noncoding transcript Het
Vps13c T C 9: 67,957,556 F3049S probably damaging Het
Vstm2l T C 2: 157,935,435 W78R probably damaging Het
Wbp1l C A 19: 46,654,256 A216D possibly damaging Het
Zer1 C G 2: 30,104,854 V510L probably damaging Het
Zfp28 A T 7: 6,394,851 probably null Het
Zfp352 C A 4: 90,225,104 P494T possibly damaging Het
Zfp353-ps A G 8: 42,082,563 noncoding transcript Het
Zfp563 A T 17: 33,102,541 probably null Het
Zim1 T C 7: 6,677,321 N448D probably benign Het
Other mutations in Tdrd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Tdrd7 APN 4 46010889 missense probably damaging 1.00
IGL01541:Tdrd7 APN 4 46018551 missense possibly damaging 0.90
IGL01901:Tdrd7 APN 4 45989225 splice site probably benign
IGL02812:Tdrd7 APN 4 45994406 missense probably benign 0.08
A5278:Tdrd7 UTSW 4 46007622 missense probably benign 0.01
R0049:Tdrd7 UTSW 4 45987582 missense probably damaging 1.00
R0049:Tdrd7 UTSW 4 45987582 missense probably damaging 1.00
R0389:Tdrd7 UTSW 4 46016987 missense probably benign 0.01
R0452:Tdrd7 UTSW 4 45965488 splice site probably benign
R0639:Tdrd7 UTSW 4 45989102 missense probably benign 0.00
R0681:Tdrd7 UTSW 4 46016879 missense probably benign 0.45
R0925:Tdrd7 UTSW 4 46025758 missense probably damaging 1.00
R0944:Tdrd7 UTSW 4 46029762 missense probably benign 0.01
R1586:Tdrd7 UTSW 4 45994445 missense probably benign 0.39
R1770:Tdrd7 UTSW 4 45987681 splice site probably benign
R1945:Tdrd7 UTSW 4 45965474 missense probably benign 0.00
R4400:Tdrd7 UTSW 4 46005540 missense possibly damaging 0.87
R4457:Tdrd7 UTSW 4 46007526 missense probably benign 0.04
R4898:Tdrd7 UTSW 4 46005616 missense possibly damaging 0.94
R5152:Tdrd7 UTSW 4 46013191 missense probably damaging 1.00
R5197:Tdrd7 UTSW 4 46034350 missense probably damaging 1.00
R5326:Tdrd7 UTSW 4 46029757 missense probably benign 0.01
R5473:Tdrd7 UTSW 4 46020877 missense possibly damaging 0.95
R5542:Tdrd7 UTSW 4 46029757 missense probably benign 0.01
R5554:Tdrd7 UTSW 4 46005358 missense possibly damaging 0.92
R5588:Tdrd7 UTSW 4 45992225 missense probably benign 0.18
R5776:Tdrd7 UTSW 4 46005689 missense probably benign 0.00
R5786:Tdrd7 UTSW 4 45989082 missense probably benign 0.09
R6063:Tdrd7 UTSW 4 46005486 missense probably benign 0.00
R6340:Tdrd7 UTSW 4 45994517 missense probably damaging 0.99
R7130:Tdrd7 UTSW 4 46029693 missense not run
X0063:Tdrd7 UTSW 4 45992268 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCGTCTCAAAGGGAACATGTG -3'
(R):5'- AGTCATGAATCCAGGTGTCAGTG -3'

Sequencing Primer
(F):5'- AACATGTGTCTGCAGGTAGTCTCAC -3'
(R):5'- AATCCAGGTGTCAGTGTCGGG -3'
Posted On2016-10-05