Incidental Mutation 'R5524:Npas3'
ID431767
Institutional Source Beutler Lab
Gene Symbol Npas3
Ensembl Gene ENSMUSG00000021010
Gene Nameneuronal PAS domain protein 3
Synonyms4930423H22Rik, bHLHe12
MMRRC Submission 043082-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.837) question?
Stock #R5524 (G1)
Quality Score114
Status Validated
Chromosome12
Chromosomal Location53248677-54072175 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54068938 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 863 (V863A)
Ref Sequence ENSEMBL: ENSMUSP00000152452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101432] [ENSMUST00000223057] [ENSMUST00000223358]
Predicted Effect possibly damaging
Transcript: ENSMUST00000101432
AA Change: V881A

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000098975
Gene: ENSMUSG00000021010
AA Change: V881A

DomainStartEndE-ValueType
HLH 64 119 1.34e-6 SMART
PAS 154 220 8.69e-11 SMART
low complexity region 234 256 N/A INTRINSIC
PAS 326 392 7.4e-5 SMART
PAC 398 441 2.46e-1 SMART
low complexity region 461 477 N/A INTRINSIC
low complexity region 524 544 N/A INTRINSIC
low complexity region 598 627 N/A INTRINSIC
low complexity region 696 709 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
low complexity region 759 773 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185390
Predicted Effect possibly damaging
Transcript: ENSMUST00000223057
AA Change: V863A

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000223358
AA Change: V850A

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic helix-loop-helix and PAS domain-containing family of transcription factors. The encoded protein is localized to the nucleus and may regulate genes involved in neurogenesis. Chromosomal abnormalities that affect the coding potential of this gene are associated with schizophrenia and mental retardation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for some knock-out alleles exhibit abnormal behavior and nervous system morphology. Mice homozygous for another knock-out allele exhibit defective lung branching morphogenesis and die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010L04Rik T A 7: 82,853,942 noncoding transcript Het
6030469F06Rik A G 12: 31,184,863 noncoding transcript Het
A830031A19Rik T A 11: 24,058,776 I13F unknown Het
Acsbg2 A C 17: 56,850,197 L309R probably damaging Het
Adam32 A T 8: 24,922,312 M76K probably damaging Het
Adamts14 C A 10: 61,230,443 R297L probably damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Asb14 A G 14: 26,900,451 K80E possibly damaging Het
Baiap2l1 T C 5: 144,280,949 T276A probably benign Het
Cacna1d G A 14: 30,042,129 P2127S probably benign Het
Ces2g A G 8: 104,966,895 T403A probably benign Het
Cgn A C 3: 94,779,989 M1R probably null Het
Chd5 T G 4: 152,376,630 S1226A probably benign Het
Col18a1 A G 10: 77,058,724 V1497A probably damaging Het
Cpd A T 11: 76,797,901 Y848* probably null Het
Cyp2a12 T C 7: 27,031,231 V207A probably benign Het
Cyth1 G A 11: 118,182,767 R247W probably benign Het
Derl3 T C 10: 75,894,490 V129A possibly damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Eml1 A T 12: 108,521,376 I518L probably damaging Het
Eri1 A G 8: 35,478,609 V174A probably benign Het
Fgd3 T A 13: 49,277,577 I435F probably damaging Het
Foxd1 T G 13: 98,355,904 S429A unknown Het
Ftcd T A 10: 76,589,331 probably benign Het
Gm5478 G T 15: 101,644,667 N323K probably benign Het
Gnpda1 G T 18: 38,335,108 P45Q probably damaging Het
Kif20a G T 18: 34,630,625 probably null Het
Klrb1 T C 6: 128,712,333 probably null Het
Lcorl C A 5: 45,775,522 probably null Het
Lcorl T A 5: 45,775,523 probably null Het
Lrp1b T A 2: 41,110,888 K2108M probably damaging Het
Lyst C T 13: 13,746,779 P3437S probably benign Het
Macrod2 A T 2: 142,317,943 M349L possibly damaging Het
March7 T C 2: 60,245,303 probably benign Het
Mcm9 A T 10: 53,548,690 C601* probably null Het
Muc19 G T 15: 91,894,393 noncoding transcript Het
Mycbp2 T C 14: 103,295,237 D427G probably damaging Het
Nap1l5 C A 6: 58,906,778 V64L possibly damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nr2c2 T A 6: 92,139,765 probably null Het
Olfr181 C T 16: 58,925,809 C254Y probably benign Het
Olfr43 A T 11: 74,206,583 L211Q probably damaging Het
Olfr44 C T 9: 39,484,987 V89M probably damaging Het
Oosp3 T C 19: 11,705,430 F56S possibly damaging Het
Plgrkt G A 19: 29,350,450 P78S probably damaging Het
Prss36 G A 7: 127,934,465 Q56* probably null Het
Ptprz1 A G 6: 22,986,318 probably null Het
Qsox2 A T 2: 26,217,687 F265I probably damaging Het
R3hcc1l G T 19: 42,563,868 E435* probably null Het
Shbg T C 11: 69,616,762 D163G probably benign Het
Skint7 T A 4: 111,980,349 L108H probably damaging Het
Smtnl1 T A 2: 84,818,894 E5D probably benign Het
Spock1 C T 13: 57,556,795 G120D probably damaging Het
Stk11ip G T 1: 75,532,327 C700F probably damaging Het
Sult4a1 C T 15: 84,089,958 probably null Het
Syngap1 A G 17: 26,957,152 H138R probably damaging Het
Tdrd7 A G 4: 46,034,301 K1016E probably benign Het
Tmem167b T C 3: 108,560,253 K26E possibly damaging Het
Tnfaip3 A G 10: 19,008,195 S146P probably damaging Het
Ttn C T 2: 76,776,716 V16242I possibly damaging Het
Vmn2r-ps3 T A 3: 64,053,449 noncoding transcript Het
Vps13c T C 9: 67,957,556 F3049S probably damaging Het
Vstm2l T C 2: 157,935,435 W78R probably damaging Het
Wbp1l C A 19: 46,654,256 A216D possibly damaging Het
Zer1 C G 2: 30,104,854 V510L probably damaging Het
Zfp28 A T 7: 6,394,851 probably null Het
Zfp352 C A 4: 90,225,104 P494T possibly damaging Het
Zfp353-ps A G 8: 42,082,563 noncoding transcript Het
Zfp563 A T 17: 33,102,541 probably null Het
Zim1 T C 7: 6,677,321 N448D probably benign Het
Other mutations in Npas3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Npas3 APN 12 54003560 missense probably damaging 1.00
IGL01330:Npas3 APN 12 54048819 missense probably damaging 1.00
IGL01376:Npas3 APN 12 54044586 missense probably benign 0.01
IGL01634:Npas3 APN 12 53947163 missense probably damaging 1.00
IGL02456:Npas3 APN 12 54048767 missense probably damaging 0.99
IGL02663:Npas3 APN 12 54068908 missense probably damaging 1.00
IGL02731:Npas3 APN 12 54067795 missense probably benign 0.01
IGL02955:Npas3 APN 12 53501265 missense probably damaging 0.96
IGL03001:Npas3 APN 12 53501192 missense probably damaging 1.00
IGL03047:Npas3 APN 12 53831687 splice site probably benign
ANU05:Npas3 UTSW 12 54068074 missense possibly damaging 0.49
IGL02837:Npas3 UTSW 12 53947197 missense possibly damaging 0.79
R0042:Npas3 UTSW 12 54048841 missense probably damaging 1.00
R0042:Npas3 UTSW 12 54048841 missense probably damaging 1.00
R0396:Npas3 UTSW 12 53831745 missense probably damaging 1.00
R1687:Npas3 UTSW 12 54048875 splice site probably null
R1863:Npas3 UTSW 12 54068826 missense probably damaging 1.00
R2004:Npas3 UTSW 12 54067897 missense possibly damaging 0.63
R2047:Npas3 UTSW 12 54068829 missense probably damaging 0.99
R2049:Npas3 UTSW 12 54062088 missense probably damaging 1.00
R2278:Npas3 UTSW 12 53640502 missense possibly damaging 0.92
R2323:Npas3 UTSW 12 54068346 missense probably damaging 1.00
R2871:Npas3 UTSW 12 54068013 nonsense probably null
R2871:Npas3 UTSW 12 54068013 nonsense probably null
R3116:Npas3 UTSW 12 54067725 splice site probably null
R3431:Npas3 UTSW 12 54069049 missense probably damaging 0.99
R3731:Npas3 UTSW 12 53354392 missense probably benign 0.11
R3767:Npas3 UTSW 12 54069074 makesense probably null
R4332:Npas3 UTSW 12 54062069 missense probably damaging 0.99
R4593:Npas3 UTSW 12 54068497 missense probably benign 0.08
R4601:Npas3 UTSW 12 54044578 missense probably damaging 0.99
R4654:Npas3 UTSW 12 54062132 critical splice donor site probably null
R4946:Npas3 UTSW 12 54065835 missense probably damaging 1.00
R5140:Npas3 UTSW 12 53501114 nonsense probably null
R5302:Npas3 UTSW 12 54068836 missense probably damaging 1.00
R5735:Npas3 UTSW 12 54003479 missense probably benign 0.00
R6252:Npas3 UTSW 12 54068890 missense probably damaging 1.00
R6438:Npas3 UTSW 12 54068698 missense probably damaging 0.99
R6987:Npas3 UTSW 12 54068253 missense possibly damaging 0.94
R6994:Npas3 UTSW 12 54068793 missense probably damaging 0.96
R7304:Npas3 UTSW 12 54069041 missense probably damaging 1.00
X0003:Npas3 UTSW 12 54044728 splice site probably null
X0064:Npas3 UTSW 12 53354384 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTACACCACGGGCACTATC -3'
(R):5'- CCAGCTCGAATTCAAAGTGCTAG -3'

Sequencing Primer
(F):5'- GGCACTATCCGCTACGCAC -3'
(R):5'- TTCAAAGTGCTAGAATGAAAGGTC -3'
Posted On2016-10-05