Incidental Mutation 'R5524:Zfp563'
ID431784
Institutional Source Beutler Lab
Gene Symbol Zfp563
Ensembl Gene ENSMUSG00000067424
Gene Namezinc finger protein 563
Synonymszinc finger protein, Zfp413
MMRRC Submission 043082-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5524 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33089310-33106203 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 33102541 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000131722] [ENSMUST00000140829]
Predicted Effect probably null
Transcript: ENSMUST00000131722
SMART Domains Protein: ENSMUSP00000118809
Gene: ENSMUSG00000067424

DomainStartEndE-ValueType
KRAB 4 61 5.45e-16 SMART
ZnF_C2H2 141 163 2.63e2 SMART
ZnF_C2H2 169 191 9.08e-4 SMART
ZnF_C2H2 197 219 9.88e-5 SMART
ZnF_C2H2 225 247 3.16e-3 SMART
ZnF_C2H2 253 275 5.81e-2 SMART
ZnF_C2H2 281 303 2.4e-3 SMART
ZnF_C2H2 309 331 1.82e-3 SMART
ZnF_C2H2 337 359 1.72e-4 SMART
ZnF_C2H2 365 387 4.54e-4 SMART
ZnF_C2H2 393 415 7.78e-3 SMART
ZnF_C2H2 421 443 3.63e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000140829
SMART Domains Protein: ENSMUSP00000121678
Gene: ENSMUSG00000067424

DomainStartEndE-ValueType
KRAB 4 61 5.45e-16 SMART
ZnF_C2H2 141 163 2.63e2 SMART
ZnF_C2H2 169 191 9.08e-4 SMART
Pfam:zf-C2H2_4 197 209 9.4e-2 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000153072
SMART Domains Protein: ENSMUSP00000119142
Gene: ENSMUSG00000067424

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
KRAB 45 102 5.45e-16 SMART
Meta Mutation Damage Score 0.554 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (76/76)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010L04Rik T A 7: 82,853,942 noncoding transcript Het
6030469F06Rik A G 12: 31,184,863 noncoding transcript Het
A830031A19Rik T A 11: 24,058,776 I13F unknown Het
Acsbg2 A C 17: 56,850,197 L309R probably damaging Het
Adam32 A T 8: 24,922,312 M76K probably damaging Het
Adamts14 C A 10: 61,230,443 R297L probably damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Asb14 A G 14: 26,900,451 K80E possibly damaging Het
Baiap2l1 T C 5: 144,280,949 T276A probably benign Het
Cacna1d G A 14: 30,042,129 P2127S probably benign Het
Ces2g A G 8: 104,966,895 T403A probably benign Het
Cgn A C 3: 94,779,989 M1R probably null Het
Chd5 T G 4: 152,376,630 S1226A probably benign Het
Col18a1 A G 10: 77,058,724 V1497A probably damaging Het
Cpd A T 11: 76,797,901 Y848* probably null Het
Cyp2a12 T C 7: 27,031,231 V207A probably benign Het
Cyth1 G A 11: 118,182,767 R247W probably benign Het
Derl3 T C 10: 75,894,490 V129A possibly damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Eml1 A T 12: 108,521,376 I518L probably damaging Het
Eri1 A G 8: 35,478,609 V174A probably benign Het
Fgd3 T A 13: 49,277,577 I435F probably damaging Het
Foxd1 T G 13: 98,355,904 S429A unknown Het
Ftcd T A 10: 76,589,331 probably benign Het
Gm5478 G T 15: 101,644,667 N323K probably benign Het
Gnpda1 G T 18: 38,335,108 P45Q probably damaging Het
Kif20a G T 18: 34,630,625 probably null Het
Klrb1 T C 6: 128,712,333 probably null Het
Lcorl C A 5: 45,775,522 probably null Het
Lcorl T A 5: 45,775,523 probably null Het
Lrp1b T A 2: 41,110,888 K2108M probably damaging Het
Lyst C T 13: 13,746,779 P3437S probably benign Het
Macrod2 A T 2: 142,317,943 M349L possibly damaging Het
March7 T C 2: 60,245,303 probably benign Het
Mcm9 A T 10: 53,548,690 C601* probably null Het
Muc19 G T 15: 91,894,393 noncoding transcript Het
Mycbp2 T C 14: 103,295,237 D427G probably damaging Het
Nap1l5 C A 6: 58,906,778 V64L possibly damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Npas3 T C 12: 54,068,938 V863A possibly damaging Het
Nr2c2 T A 6: 92,139,765 probably null Het
Olfr181 C T 16: 58,925,809 C254Y probably benign Het
Olfr43 A T 11: 74,206,583 L211Q probably damaging Het
Olfr44 C T 9: 39,484,987 V89M probably damaging Het
Oosp3 T C 19: 11,705,430 F56S possibly damaging Het
Plgrkt G A 19: 29,350,450 P78S probably damaging Het
Prss36 G A 7: 127,934,465 Q56* probably null Het
Ptprz1 A G 6: 22,986,318 probably null Het
Qsox2 A T 2: 26,217,687 F265I probably damaging Het
R3hcc1l G T 19: 42,563,868 E435* probably null Het
Shbg T C 11: 69,616,762 D163G probably benign Het
Skint7 T A 4: 111,980,349 L108H probably damaging Het
Smtnl1 T A 2: 84,818,894 E5D probably benign Het
Spock1 C T 13: 57,556,795 G120D probably damaging Het
Stk11ip G T 1: 75,532,327 C700F probably damaging Het
Sult4a1 C T 15: 84,089,958 probably null Het
Syngap1 A G 17: 26,957,152 H138R probably damaging Het
Tdrd7 A G 4: 46,034,301 K1016E probably benign Het
Tmem167b T C 3: 108,560,253 K26E possibly damaging Het
Tnfaip3 A G 10: 19,008,195 S146P probably damaging Het
Ttn C T 2: 76,776,716 V16242I possibly damaging Het
Vmn2r-ps3 T A 3: 64,053,449 noncoding transcript Het
Vps13c T C 9: 67,957,556 F3049S probably damaging Het
Vstm2l T C 2: 157,935,435 W78R probably damaging Het
Wbp1l C A 19: 46,654,256 A216D possibly damaging Het
Zer1 C G 2: 30,104,854 V510L probably damaging Het
Zfp28 A T 7: 6,394,851 probably null Het
Zfp352 C A 4: 90,225,104 P494T possibly damaging Het
Zfp353-ps A G 8: 42,082,563 noncoding transcript Het
Zim1 T C 7: 6,677,321 N448D probably benign Het
Other mutations in Zfp563
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Zfp563 APN 17 33104626 missense probably damaging 1.00
IGL01981:Zfp563 APN 17 33105409 missense probably benign 0.16
IGL02407:Zfp563 APN 17 33104821 missense probably benign 0.00
IGL02662:Zfp563 APN 17 33102279 missense probably damaging 1.00
IGL03220:Zfp563 APN 17 33104687 missense probably benign 0.44
R0241:Zfp563 UTSW 17 33104685 missense possibly damaging 0.61
R0241:Zfp563 UTSW 17 33104685 missense possibly damaging 0.61
R0537:Zfp563 UTSW 17 33104685 missense possibly damaging 0.61
R0552:Zfp563 UTSW 17 33104685 missense possibly damaging 0.61
R1544:Zfp563 UTSW 17 33105213 missense probably benign 0.01
R3763:Zfp563 UTSW 17 33104928 nonsense probably null
R3979:Zfp563 UTSW 17 33105727 missense probably benign 0.03
R4938:Zfp563 UTSW 17 33105709 missense probably damaging 1.00
R5280:Zfp563 UTSW 17 33104838 missense probably damaging 0.99
R5383:Zfp563 UTSW 17 33104707 missense probably benign
R5485:Zfp563 UTSW 17 33089566 unclassified probably benign
R5567:Zfp563 UTSW 17 33089457 unclassified probably benign
R5736:Zfp563 UTSW 17 33104986 missense possibly damaging 0.91
R5758:Zfp563 UTSW 17 33104920 missense probably damaging 1.00
R6034:Zfp563 UTSW 17 33104961 missense probably damaging 0.96
R6034:Zfp563 UTSW 17 33104961 missense probably damaging 0.96
R6532:Zfp563 UTSW 17 33105698 missense probably benign 0.21
X0023:Zfp563 UTSW 17 33105721 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTGCTTGGAGAAGGTATCT -3'
(R):5'- AGAAGATCAACTGTATCATCTTGTTAG -3'

Sequencing Primer
(F):5'- GGATTTACTGGATCCTTCCCAGAAG -3'
(R):5'- GAATGTCTGTGCAACACCTG -3'
Posted On2016-10-05