Incidental Mutation 'R5525:Rabep1'
ID431821
Institutional Source Beutler Lab
Gene Symbol Rabep1
Ensembl Gene ENSMUSG00000020817
Gene Namerabaptin, RAB GTPase binding effector protein 1
Synonymsneurocrescin, RAB5 effector protein, rabaptin-5
MMRRC Submission 043083-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.437) question?
Stock #R5525 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location70844778-70943105 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70923146 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 554 (S554T)
Ref Sequence ENSEMBL: ENSMUSP00000137267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076270] [ENSMUST00000081362] [ENSMUST00000100928] [ENSMUST00000108533] [ENSMUST00000177731] [ENSMUST00000178245]
Predicted Effect probably damaging
Transcript: ENSMUST00000076270
AA Change: S597T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075619
Gene: ENSMUSG00000020817
AA Change: S597T

DomainStartEndE-ValueType
Pfam:Rabaptin 89 195 8.8e-47 PFAM
low complexity region 314 327 N/A INTRINSIC
Pfam:Rabaptin 461 596 7.6e-39 PFAM
Pfam:Rab5-bind 612 807 5.7e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000081362
AA Change: S557T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080102
Gene: ENSMUSG00000020817
AA Change: S557T

DomainStartEndE-ValueType
Pfam:Rabaptin 89 198 2.4e-45 PFAM
low complexity region 274 287 N/A INTRINSIC
Pfam:Rabaptin 421 556 7.1e-39 PFAM
Pfam:Rab5-bind 572 767 5.2e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100928
AA Change: S562T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098488
Gene: ENSMUSG00000020817
AA Change: S562T

DomainStartEndE-ValueType
Pfam:Rabaptin 89 195 8.3e-47 PFAM
low complexity region 314 327 N/A INTRINSIC
Pfam:Rabaptin 461 561 2.9e-27 PFAM
Pfam:Rab5-bind 577 772 5.3e-51 PFAM
low complexity region 803 817 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108533
AA Change: S597T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104173
Gene: ENSMUSG00000020817
AA Change: S597T

DomainStartEndE-ValueType
Pfam:Rabaptin 9 495 2.8e-301 PFAM
Pfam:Rab5-bind 533 841 2e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142220
Predicted Effect probably damaging
Transcript: ENSMUST00000177731
AA Change: S513T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136069
Gene: ENSMUSG00000020817
AA Change: S513T

DomainStartEndE-ValueType
Pfam:Rabaptin 5 111 6.2e-47 PFAM
low complexity region 230 243 N/A INTRINSIC
Pfam:Rabaptin 377 512 5.3e-39 PFAM
Pfam:Rab5-bind 528 723 1.4e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178245
AA Change: S554T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137267
Gene: ENSMUSG00000020817
AA Change: S554T

DomainStartEndE-ValueType
Pfam:Rabaptin 46 152 8.2e-47 PFAM
low complexity region 271 284 N/A INTRINSIC
Pfam:Rabaptin 418 553 7e-39 PFAM
Pfam:Rab5-bind 569 764 5.2e-51 PFAM
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,983 T1501A probably benign Het
Acin1 G A 14: 54,664,391 A648V possibly damaging Het
Agap1 A G 1: 89,743,773 T401A possibly damaging Het
Anapc4 T G 5: 52,856,809 M440R probably damaging Het
Ankrd26 A G 6: 118,527,731 M739T probably benign Het
Brip1 T C 11: 86,110,447 E721G possibly damaging Het
Bzw1 A G 1: 58,402,906 E221G possibly damaging Het
Cenpm A C 15: 82,239,291 probably null Het
Exosc1 T A 19: 41,924,018 K143N probably damaging Het
Fgd5 T A 6: 92,066,247 L1236Q probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grm3 C T 5: 9,504,872 V807I probably damaging Het
Kndc1 A G 7: 139,924,111 N1110S probably benign Het
Magi1 A T 6: 93,792,373 V17D possibly damaging Het
Mdn1 T G 4: 32,767,961 M5298R possibly damaging Het
Nlrp9c T A 7: 26,384,501 E551V probably damaging Het
Oacyl A C 18: 65,745,356 I457L probably benign Het
Olfr103 C T 17: 37,336,626 G202D probably damaging Het
Olfr1102 A T 2: 87,002,339 E123D possibly damaging Het
Olfr494 A G 7: 108,367,999 I170V probably benign Het
Rab11fip3 T C 17: 25,991,295 E996G probably damaging Het
Rln1 T C 19: 29,334,520 E26G probably benign Het
Rpf1 A G 3: 146,517,804 silent Het
Sdk1 T C 5: 142,185,265 V1961A possibly damaging Het
Serpinb8 A T 1: 107,607,293 I365F probably damaging Het
Shank2 A G 7: 144,070,109 D277G probably damaging Het
Snapc4 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 2: 26,369,526 probably benign Het
Thsd7a T C 6: 12,332,007 T1269A possibly damaging Het
Ttll3 A G 6: 113,412,978 N776D probably benign Het
Unc80 A G 1: 66,606,614 E1483G possibly damaging Het
Ush2a A G 1: 188,753,606 D2971G probably benign Het
Zfp322a A G 13: 23,357,515 V19A probably benign Het
Zfp462 C A 4: 55,050,281 P2164T possibly damaging Het
Other mutations in Rabep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Rabep1 APN 11 70925781 missense probably benign 0.00
IGL02022:Rabep1 APN 11 70934559 missense probably damaging 1.00
IGL02215:Rabep1 APN 11 70923197 nonsense probably null
IGL02428:Rabep1 APN 11 70917480 missense probably benign 0.00
IGL02566:Rabep1 APN 11 70917714 missense probably damaging 1.00
IGL02868:Rabep1 APN 11 70874746 missense probably benign 0.00
F5770:Rabep1 UTSW 11 70937516 splice site probably benign
P0042:Rabep1 UTSW 11 70884975 splice site probably benign
PIT4495001:Rabep1 UTSW 11 70917579 missense probably damaging 1.00
R0328:Rabep1 UTSW 11 70919207 missense probably damaging 1.00
R0458:Rabep1 UTSW 11 70886998 splice site probably null
R0477:Rabep1 UTSW 11 70920907 missense probably damaging 1.00
R0727:Rabep1 UTSW 11 70900492 nonsense probably null
R1732:Rabep1 UTSW 11 70904641 missense probably damaging 1.00
R1837:Rabep1 UTSW 11 70904658 missense probably damaging 1.00
R2203:Rabep1 UTSW 11 70934574 missense probably damaging 1.00
R4003:Rabep1 UTSW 11 70917367 missense probably benign 0.12
R4229:Rabep1 UTSW 11 70908434 missense probably benign
R4573:Rabep1 UTSW 11 70917751 missense probably damaging 1.00
R4748:Rabep1 UTSW 11 70908468 missense probably benign 0.18
R5130:Rabep1 UTSW 11 70904731 missense probably damaging 1.00
R5182:Rabep1 UTSW 11 70904628 nonsense probably null
R5379:Rabep1 UTSW 11 70908421 missense probably damaging 1.00
R5617:Rabep1 UTSW 11 70917529 missense probably damaging 1.00
R6060:Rabep1 UTSW 11 70874786 missense possibly damaging 0.87
R6283:Rabep1 UTSW 11 70917679 missense probably damaging 1.00
R6302:Rabep1 UTSW 11 70935121 missense probably damaging 1.00
R6730:Rabep1 UTSW 11 70940386 missense possibly damaging 0.88
R6988:Rabep1 UTSW 11 70934537 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCTAATGCCCTGGTGTACTG -3'
(R):5'- GCGTCTGGACAGTATTCACC -3'

Sequencing Primer
(F):5'- CTAATGCCCTGGTGTACTGGAAAG -3'
(R):5'- TCCAGCAGAAGTCACGTTCAG -3'
Posted On2016-10-05