Incidental Mutation 'R0478:Mrpl50'
ID 43192
Institutional Source Beutler Lab
Gene Symbol Mrpl50
Ensembl Gene ENSMUSG00000044018
Gene Name mitochondrial ribosomal protein L50
Synonyms D4Wsu125e
MMRRC Submission 038678-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.172) question?
Stock # R0478 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 49512597-49521083 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 49514513 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 53 (C53R)
Ref Sequence ENSEMBL: ENSMUSP00000062476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057829]
AlphaFold Q8VDT9
Predicted Effect probably damaging
Transcript: ENSMUST00000057829
AA Change: C53R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062476
Gene: ENSMUSG00000044018
AA Change: C53R

DomainStartEndE-ValueType
low complexity region 32 55 N/A INTRINSIC
Pfam:Ribosomal_L50 61 156 1.3e-15 PFAM
Meta Mutation Damage Score 0.5729 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a putative 39S subunit protein and belongs to the L47P ribosomal protein family. Pseudogenes corresponding to this gene are found on chromosomes 2p, 2q, 5p, and 10q. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,262,014 (GRCm39) noncoding transcript Het
4930556J24Rik T G 11: 3,926,259 (GRCm39) probably benign Het
Acnat1 T G 4: 49,450,901 (GRCm39) D70A probably damaging Het
Adnp2 A G 18: 80,172,549 (GRCm39) V620A probably benign Het
Aldoart1 T A 4: 72,770,580 (GRCm39) H21L probably benign Het
Birc2 A G 9: 7,860,348 (GRCm39) V290A probably damaging Het
Bpifb3 C T 2: 153,773,400 (GRCm39) probably benign Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Clmn A G 12: 104,751,750 (GRCm39) M235T probably damaging Het
Dmbt1 A G 7: 130,642,917 (GRCm39) E245G possibly damaging Het
Epgn G T 5: 91,178,987 (GRCm39) V36L probably benign Het
Ets2 C A 16: 95,517,306 (GRCm39) P346Q probably damaging Het
Fam222b T C 11: 78,044,682 (GRCm39) L81P probably damaging Het
Fancf A C 7: 51,511,440 (GRCm39) L188R probably damaging Het
Fibin T C 2: 110,193,079 (GRCm39) D21G possibly damaging Het
Fzd6 A G 15: 38,897,429 (GRCm39) probably null Het
Gbp4 T A 5: 105,267,299 (GRCm39) Q540L probably benign Het
Greb1l T A 18: 10,509,281 (GRCm39) L531Q probably damaging Het
Il5ra A G 6: 106,715,423 (GRCm39) V137A probably benign Het
Kif26a G A 12: 112,142,223 (GRCm39) A826T probably damaging Het
Kiz T C 2: 146,784,078 (GRCm39) V537A possibly damaging Het
Klhl32 C T 4: 24,792,777 (GRCm39) G15D probably damaging Het
Kmt2d G A 15: 98,751,462 (GRCm39) probably benign Het
Lbp T C 2: 158,159,448 (GRCm39) probably benign Het
Mmp25 T C 17: 23,851,756 (GRCm39) T318A probably benign Het
Msl3l2 G C 10: 55,991,411 (GRCm39) E45D probably damaging Het
Nfxl1 A G 5: 72,681,988 (GRCm39) probably null Het
Noc3l A G 19: 38,798,450 (GRCm39) probably null Het
Or12e7 T A 2: 87,288,370 (GRCm39) V287E probably damaging Het
Or1x6 T C 11: 50,939,539 (GRCm39) S202P probably benign Het
Pgm5 A T 19: 24,812,233 (GRCm39) S100T possibly damaging Het
Pi4ka C T 16: 17,127,175 (GRCm39) G1093S possibly damaging Het
Pitrm1 T A 13: 6,609,431 (GRCm39) S350T probably damaging Het
Ptk2b G T 14: 66,450,821 (GRCm39) N48K probably damaging Het
Septin3 T C 15: 82,175,007 (GRCm39) L172P probably damaging Het
Sirt3 A T 7: 140,458,027 (GRCm39) C41S Het
Sphkap C T 1: 83,256,432 (GRCm39) R152H probably damaging Het
St3gal1 T C 15: 66,985,579 (GRCm39) Y25C probably damaging Het
Tbc1d31 T C 15: 57,795,932 (GRCm39) F175S probably damaging Het
Tfdp2 T A 9: 96,172,636 (GRCm39) D43E probably benign Het
Tgm1 G A 14: 55,937,791 (GRCm39) Q773* probably null Het
Tmc3 A T 7: 83,271,360 (GRCm39) R837S possibly damaging Het
Unc13a A G 8: 72,103,792 (GRCm39) V880A possibly damaging Het
Vmn1r237 T A 17: 21,535,081 (GRCm39) V268E probably damaging Het
Zan C T 5: 137,398,788 (GRCm39) probably benign Het
Zfp760 G T 17: 21,940,995 (GRCm39) E57* probably null Het
Other mutations in Mrpl50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02966:Mrpl50 APN 4 49,521,014 (GRCm39) missense probably benign 0.26
R0348:Mrpl50 UTSW 4 49,514,515 (GRCm39) missense probably damaging 0.97
R0706:Mrpl50 UTSW 4 49,514,198 (GRCm39) missense probably benign
R3829:Mrpl50 UTSW 4 49,514,539 (GRCm39) missense probably damaging 1.00
R4572:Mrpl50 UTSW 4 49,514,399 (GRCm39) missense possibly damaging 0.74
R4903:Mrpl50 UTSW 4 49,514,488 (GRCm39) missense probably damaging 1.00
R9511:Mrpl50 UTSW 4 49,514,501 (GRCm39) nonsense probably null
R9546:Mrpl50 UTSW 4 49,514,338 (GRCm39) missense probably damaging 1.00
R9547:Mrpl50 UTSW 4 49,514,338 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGGCCTAAGCCATCAGCTAAG -3'
(R):5'- CGCATGTCTGAGGAGTTGTTTTCCATC -3'

Sequencing Primer
(F):5'- AGCCTGCTAAGAGTCTGAACTTC -3'
(R):5'- TCTCCACTGCGCTCAGAAAG -3'
Posted On 2013-05-23