Incidental Mutation 'R5527:Nlrc5'
ID431932
Institutional Source Beutler Lab
Gene Symbol Nlrc5
Ensembl Gene ENSMUSG00000074151
Gene NameNLR family, CARD domain containing 5
SynonymsAI451557
MMRRC Submission 043085-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5527 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location94434356-94527272 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94490416 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 1011 (H1011R)
Ref Sequence ENSEMBL: ENSMUSP00000148677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053085] [ENSMUST00000182409] [ENSMUST00000211816]
Predicted Effect probably damaging
Transcript: ENSMUST00000053085
AA Change: H1011R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138322
Gene: ENSMUSG00000074151
AA Change: H1011R

DomainStartEndE-ValueType
low complexity region 136 151 N/A INTRINSIC
Pfam:NACHT 223 386 1.8e-32 PFAM
LRR 716 743 6.89e1 SMART
LRR 744 771 9.86e1 SMART
LRR 772 796 1.22e2 SMART
LRR 844 870 2.16e2 SMART
LRR 871 898 1.76e-1 SMART
LRR 1006 1033 1.9e0 SMART
LRR 1034 1061 4.51e1 SMART
low complexity region 1141 1169 N/A INTRINSIC
LRR 1240 1267 2.67e1 SMART
LRR 1273 1295 1.22e1 SMART
low complexity region 1341 1351 N/A INTRINSIC
LRR 1519 1546 5.48e1 SMART
LRR 1547 1574 3.36e1 SMART
LRR 1575 1602 1.69e1 SMART
LRR 1603 1630 8.99e-1 SMART
LRR 1631 1654 5.26e0 SMART
LRR 1659 1686 2.81e0 SMART
LRR 1687 1714 1.6e-4 SMART
LRR 1715 1742 1.06e0 SMART
LRR 1743 1768 8e0 SMART
LRR 1793 1820 2.06e1 SMART
LRR 1821 1848 5.42e-2 SMART
LRR 1849 1876 3.54e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182409
AA Change: H1011R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000183132
Predicted Effect probably damaging
Transcript: ENSMUST00000211816
AA Change: H1011R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 94.9%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the caspase recruitment domain-containing NLR family. This gene plays a role in cytokine response and antiviral immunity through its inhibition of NF-kappa-B activation and negative regulation of type I interferon signaling pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal cytokine production induced by virus and bacteria infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,460,978 Y1051N probably benign Het
Bach1 T C 16: 87,719,545 S325P probably benign Het
Baz2a T C 10: 128,124,917 S1529P probably damaging Het
BC027072 A T 17: 71,752,640 V14D probably damaging Het
Bicd1 T C 6: 149,494,636 L168P probably damaging Het
Cat A G 2: 103,472,973 F153S probably damaging Het
Ccnt2 T C 1: 127,802,664 M426T probably benign Het
Cdk7 C T 13: 100,730,472 V38I probably damaging Het
Cenpj T C 14: 56,526,983 Y1324C probably damaging Het
Ddx47 C A 6: 135,011,694 A18E probably benign Het
Dnah2 G A 11: 69,437,188 Q3370* probably null Het
Dnah6 C T 6: 73,159,229 V976I probably benign Het
Dock7 C T 4: 98,953,868 probably benign Het
Dpy19l3 A T 7: 35,714,130 I362N possibly damaging Het
Fam118a A T 15: 85,058,798 T343S probably benign Het
Fcgbp T A 7: 28,093,635 D1021E probably benign Het
Fkbp1b T C 12: 4,833,746 Y83C probably damaging Het
Flt4 T C 11: 49,634,754 I709T probably damaging Het
Gga3 G T 11: 115,587,436 A510D probably damaging Het
Heatr1 T C 13: 12,402,760 I264T probably damaging Het
Heatr1 T C 13: 12,404,948 I384T probably benign Het
Hes2 T C 4: 152,160,392 V106A probably benign Het
Igf1r T A 7: 68,207,821 M1083K probably damaging Het
Il7r A T 15: 9,512,924 D166E probably benign Het
Ipo4 G A 14: 55,632,050 probably null Het
Klk1b26 T C 7: 44,012,763 I15T probably benign Het
Krt42 T C 11: 100,263,295 probably benign Het
Lag3 T C 6: 124,908,629 T263A probably damaging Het
Lilra6 T A 7: 3,914,587 probably benign Het
Lrrc31 T A 3: 30,691,228 H90L probably damaging Het
Lvrn G A 18: 46,873,803 D331N probably damaging Het
Me2 A T 18: 73,791,116 W342R probably damaging Het
Mob2 A G 7: 142,009,410 F220S probably damaging Het
Mroh4 A G 15: 74,615,016 I342T probably damaging Het
Naa15 T C 3: 51,441,947 Y46H probably damaging Het
Neb A G 2: 52,334,453 V10A unknown Het
Nr1i3 A G 1: 171,214,352 T2A possibly damaging Het
Nrros T C 16: 32,144,470 N207S probably damaging Het
Olfr1356 C T 10: 78,847,775 V47M probably benign Het
Olfr553 A T 7: 102,614,561 S143T probably benign Het
Ptprz1 C T 6: 23,000,053 T714I possibly damaging Het
Rp1 T C 1: 4,346,393 T1499A possibly damaging Het
Rsg1 C A 4: 141,219,992 A228D probably damaging Het
Rubcn T C 16: 32,826,711 K771E probably damaging Het
Sbds T C 5: 130,246,406 E227G possibly damaging Het
Setd1a C T 7: 127,785,629 P8S probably damaging Het
Sh3tc2 A G 18: 62,011,861 I1129V probably benign Het
Spef1 T A 2: 131,172,741 D87V probably damaging Het
Supv3l1 C T 10: 62,429,829 R644Q probably damaging Het
Thoc6 A G 17: 23,670,795 F51S probably damaging Het
Tm4sf19 T C 16: 32,407,921 L176P probably damaging Het
Tma16 A G 8: 66,484,124 I17T possibly damaging Het
Tpd52l2 G A 2: 181,502,054 probably null Het
Ube2j1 C T 4: 33,045,164 P146S probably benign Het
Ubr4 T A 4: 139,480,788 I4960N possibly damaging Het
Usp13 A G 3: 32,865,838 D224G probably damaging Het
Uxs1 T C 1: 43,780,080 T188A probably damaging Het
Vmn2r12 A T 5: 109,086,617 Y576* probably null Het
Vmn2r73 T C 7: 85,858,367 D579G possibly damaging Het
Xpr1 T C 1: 155,290,235 N524D probably benign Het
Xrn2 A T 2: 147,029,755 I366L probably benign Het
Zfp236 A T 18: 82,658,034 V386E possibly damaging Het
Zfp292 A T 4: 34,806,261 L2261Q probably damaging Het
Zpld1 C G 16: 55,226,362 E415Q probably benign Het
Other mutations in Nlrc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Nlrc5 APN 8 94502211 splice site probably benign
IGL00232:Nlrc5 APN 8 94484623 critical splice donor site probably null
IGL00324:Nlrc5 APN 8 94521479 missense probably damaging 1.00
IGL02715:Nlrc5 APN 8 94474668 missense probably damaging 1.00
IGL02992:Nlrc5 APN 8 94506573 missense possibly damaging 0.69
IGL03095:Nlrc5 APN 8 94521908 splice site probably benign
IGL03389:Nlrc5 APN 8 94521474 missense probably damaging 1.00
IGL03406:Nlrc5 APN 8 94476855 missense probably benign 0.01
cowberry UTSW 8 94491525 missense possibly damaging 0.83
lingon UTSW 8 94481860 missense probably damaging 1.00
R0037:Nlrc5 UTSW 8 94489535 missense probably benign 0.00
R0048:Nlrc5 UTSW 8 94474656 missense possibly damaging 0.81
R0092:Nlrc5 UTSW 8 94489594 splice site probably benign
R0506:Nlrc5 UTSW 8 94493125 splice site probably benign
R0548:Nlrc5 UTSW 8 94521783 missense probably null 0.09
R2014:Nlrc5 UTSW 8 94525510 splice site probably benign
R3051:Nlrc5 UTSW 8 94476715 missense probably benign 0.01
R3776:Nlrc5 UTSW 8 94472839 missense possibly damaging 0.48
R3837:Nlrc5 UTSW 8 94511301 splice site probably benign
R4012:Nlrc5 UTSW 8 94475992 missense possibly damaging 0.92
R4367:Nlrc5 UTSW 8 94476564 missense probably damaging 1.00
R4400:Nlrc5 UTSW 8 94494353 missense probably benign 0.08
R4469:Nlrc5 UTSW 8 94520839 missense probably damaging 1.00
R4561:Nlrc5 UTSW 8 94477146 missense probably damaging 1.00
R4584:Nlrc5 UTSW 8 94477275 missense probably damaging 0.96
R4758:Nlrc5 UTSW 8 94512328 missense possibly damaging 0.70
R4834:Nlrc5 UTSW 8 94505485 missense probably benign 0.00
R4896:Nlrc5 UTSW 8 94521216 unclassified probably benign
R5004:Nlrc5 UTSW 8 94521216 unclassified probably benign
R5018:Nlrc5 UTSW 8 94525452 missense probably damaging 1.00
R5115:Nlrc5 UTSW 8 94476819 missense possibly damaging 0.67
R5116:Nlrc5 UTSW 8 94481860 missense probably damaging 1.00
R5126:Nlrc5 UTSW 8 94474671 missense possibly damaging 0.95
R5148:Nlrc5 UTSW 8 94476693 missense probably damaging 1.00
R5224:Nlrc5 UTSW 8 94494316 missense probably benign 0.26
R5640:Nlrc5 UTSW 8 94475793 missense probably benign 0.02
R5705:Nlrc5 UTSW 8 94475757 missense probably benign 0.00
R5778:Nlrc5 UTSW 8 94479526 missense possibly damaging 0.66
R5830:Nlrc5 UTSW 8 94472914 missense probably damaging 1.00
R5850:Nlrc5 UTSW 8 94521047 missense probably benign 0.00
R5978:Nlrc5 UTSW 8 94488593 missense probably damaging 0.98
R6335:Nlrc5 UTSW 8 94502274 missense probably benign 0.01
R6372:Nlrc5 UTSW 8 94479750 missense probably damaging 0.98
R6486:Nlrc5 UTSW 8 94521299 splice site probably null
R6765:Nlrc5 UTSW 8 94490368 missense probably benign 0.20
R6861:Nlrc5 UTSW 8 94521229 unclassified probably benign
R6869:Nlrc5 UTSW 8 94521955 missense probably benign 0.00
R7134:Nlrc5 UTSW 8 94479722 missense probably damaging 0.99
R7204:Nlrc5 UTSW 8 94491525 missense possibly damaging 0.83
R7231:Nlrc5 UTSW 8 94521805 critical splice donor site probably null
R7309:Nlrc5 UTSW 8 94474042 missense probably benign 0.01
R7368:Nlrc5 UTSW 8 94476393 nonsense probably null
R7497:Nlrc5 UTSW 8 94521970 missense not run
Z1088:Nlrc5 UTSW 8 94504464 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- ATGCTGTGTGTTAGTCCTCC -3'
(R):5'- AGAAAGTCACTGTCCCTCCC -3'

Sequencing Primer
(F):5'- TTCTCAATGCCATGTACCACAATC -3'
(R):5'- AACAGGACACCTGCATTC -3'
Posted On2016-10-05