Incidental Mutation 'R5527:Me2'
ID431962
Institutional Source Beutler Lab
Gene Symbol Me2
Ensembl Gene ENSMUSG00000024556
Gene Namemalic enzyme 2, NAD(+)-dependent, mitochondrial
SynonymsD030040L20Rik
MMRRC Submission 043085-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R5527 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location73770040-73815392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73791116 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 342 (W342R)
Ref Sequence ENSEMBL: ENSMUSP00000025439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025439]
Predicted Effect probably damaging
Transcript: ENSMUST00000025439
AA Change: W342R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025439
Gene: ENSMUSG00000024556
AA Change: W342R

DomainStartEndE-ValueType
malic 89 270 3.48e-98 SMART
Malic_M 280 535 2.21e-103 SMART
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 94.9%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial NAD-dependent malic enzyme, a homotetrameric protein, that catalyzes the oxidative decarboxylation of malate to pyruvate. It had previously been weakly linked to a syndrome known as Friedreich ataxia that has since been shown to be the result of mutation in a completely different gene. Certain single-nucleotide polymorphism haplotypes of this gene have been shown to increase the risk for idiopathic generalized epilepsy. Alternatively spliced transcript variants encoding different isoforms found for this gene. [provided by RefSeq, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,460,978 Y1051N probably benign Het
Bach1 T C 16: 87,719,545 S325P probably benign Het
Baz2a T C 10: 128,124,917 S1529P probably damaging Het
BC027072 A T 17: 71,752,640 V14D probably damaging Het
Bicd1 T C 6: 149,494,636 L168P probably damaging Het
Cat A G 2: 103,472,973 F153S probably damaging Het
Ccnt2 T C 1: 127,802,664 M426T probably benign Het
Cdk7 C T 13: 100,730,472 V38I probably damaging Het
Cenpj T C 14: 56,526,983 Y1324C probably damaging Het
Ddx47 C A 6: 135,011,694 A18E probably benign Het
Dnah2 G A 11: 69,437,188 Q3370* probably null Het
Dnah6 C T 6: 73,159,229 V976I probably benign Het
Dock7 C T 4: 98,953,868 probably benign Het
Dpy19l3 A T 7: 35,714,130 I362N possibly damaging Het
Fam118a A T 15: 85,058,798 T343S probably benign Het
Fcgbp T A 7: 28,093,635 D1021E probably benign Het
Fkbp1b T C 12: 4,833,746 Y83C probably damaging Het
Flt4 T C 11: 49,634,754 I709T probably damaging Het
Gga3 G T 11: 115,587,436 A510D probably damaging Het
Heatr1 T C 13: 12,402,760 I264T probably damaging Het
Heatr1 T C 13: 12,404,948 I384T probably benign Het
Hes2 T C 4: 152,160,392 V106A probably benign Het
Igf1r T A 7: 68,207,821 M1083K probably damaging Het
Il7r A T 15: 9,512,924 D166E probably benign Het
Ipo4 G A 14: 55,632,050 probably null Het
Klk1b26 T C 7: 44,012,763 I15T probably benign Het
Krt42 T C 11: 100,263,295 probably benign Het
Lag3 T C 6: 124,908,629 T263A probably damaging Het
Lilra6 T A 7: 3,914,587 probably benign Het
Lrrc31 T A 3: 30,691,228 H90L probably damaging Het
Lvrn G A 18: 46,873,803 D331N probably damaging Het
Mob2 A G 7: 142,009,410 F220S probably damaging Het
Mroh4 A G 15: 74,615,016 I342T probably damaging Het
Naa15 T C 3: 51,441,947 Y46H probably damaging Het
Neb A G 2: 52,334,453 V10A unknown Het
Nlrc5 A G 8: 94,490,416 H1011R probably damaging Het
Nr1i3 A G 1: 171,214,352 T2A possibly damaging Het
Nrros T C 16: 32,144,470 N207S probably damaging Het
Olfr1356 C T 10: 78,847,775 V47M probably benign Het
Olfr553 A T 7: 102,614,561 S143T probably benign Het
Ptprz1 C T 6: 23,000,053 T714I possibly damaging Het
Rp1 T C 1: 4,346,393 T1499A possibly damaging Het
Rsg1 C A 4: 141,219,992 A228D probably damaging Het
Rubcn T C 16: 32,826,711 K771E probably damaging Het
Sbds T C 5: 130,246,406 E227G possibly damaging Het
Setd1a C T 7: 127,785,629 P8S probably damaging Het
Sh3tc2 A G 18: 62,011,861 I1129V probably benign Het
Spef1 T A 2: 131,172,741 D87V probably damaging Het
Supv3l1 C T 10: 62,429,829 R644Q probably damaging Het
Thoc6 A G 17: 23,670,795 F51S probably damaging Het
Tm4sf19 T C 16: 32,407,921 L176P probably damaging Het
Tma16 A G 8: 66,484,124 I17T possibly damaging Het
Tpd52l2 G A 2: 181,502,054 probably null Het
Ube2j1 C T 4: 33,045,164 P146S probably benign Het
Ubr4 T A 4: 139,480,788 I4960N possibly damaging Het
Usp13 A G 3: 32,865,838 D224G probably damaging Het
Uxs1 T C 1: 43,780,080 T188A probably damaging Het
Vmn2r12 A T 5: 109,086,617 Y576* probably null Het
Vmn2r73 T C 7: 85,858,367 D579G possibly damaging Het
Xpr1 T C 1: 155,290,235 N524D probably benign Het
Xrn2 A T 2: 147,029,755 I366L probably benign Het
Zfp236 A T 18: 82,658,034 V386E possibly damaging Het
Zfp292 A T 4: 34,806,261 L2261Q probably damaging Het
Zpld1 C G 16: 55,226,362 E415Q probably benign Het
Other mutations in Me2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Me2 APN 18 73770642 missense probably benign 0.01
IGL00977:Me2 APN 18 73791177 missense probably benign 0.24
IGL01161:Me2 APN 18 73770816 splice site probably benign
IGL02351:Me2 APN 18 73797967 missense probably benign 0.20
IGL02358:Me2 APN 18 73797967 missense probably benign 0.20
IGL02647:Me2 APN 18 73797903 missense probably benign 0.00
IGL03172:Me2 APN 18 73770726 missense probably benign
baako UTSW 18 73797945 missense probably damaging 1.00
first_born UTSW 18 73791128 nonsense probably null
muster UTSW 18 73791844 missense probably benign 0.01
Roundup UTSW 18 73770673 missense probably benign
R0018:Me2 UTSW 18 73791852 missense possibly damaging 0.93
R0018:Me2 UTSW 18 73791852 missense possibly damaging 0.93
R0032:Me2 UTSW 18 73794525 missense probably benign
R0119:Me2 UTSW 18 73770673 missense probably benign
R0136:Me2 UTSW 18 73770673 missense probably benign
R0299:Me2 UTSW 18 73770673 missense probably benign
R0657:Me2 UTSW 18 73770673 missense probably benign
R1597:Me2 UTSW 18 73797945 missense probably damaging 1.00
R1638:Me2 UTSW 18 73773134 missense probably benign 0.03
R1765:Me2 UTSW 18 73791858 missense probably damaging 1.00
R1861:Me2 UTSW 18 73785714 missense probably benign 0.11
R2410:Me2 UTSW 18 73791112 missense probably damaging 0.98
R3422:Me2 UTSW 18 73791194 missense probably damaging 0.99
R3954:Me2 UTSW 18 73781132 missense probably damaging 1.00
R3957:Me2 UTSW 18 73781132 missense probably damaging 1.00
R4052:Me2 UTSW 18 73791085 missense probably benign 0.05
R4207:Me2 UTSW 18 73791085 missense probably benign 0.05
R4208:Me2 UTSW 18 73791085 missense probably benign 0.05
R4694:Me2 UTSW 18 73801859 missense probably benign 0.01
R4962:Me2 UTSW 18 73785776 missense probably damaging 1.00
R6170:Me2 UTSW 18 73785781 missense probably benign 0.07
R6185:Me2 UTSW 18 73791128 nonsense probably null
R6305:Me2 UTSW 18 73791844 missense probably benign 0.01
R6462:Me2 UTSW 18 73775399 missense probably benign 0.17
R7085:Me2 UTSW 18 73781058 missense probably damaging 1.00
R7096:Me2 UTSW 18 73794890 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGGCTTAGATGGACAGCCTG -3'
(R):5'- GAGAGACTGACAAAGAATCTACTTACG -3'

Sequencing Primer
(F):5'- GGTTAGGGTCATTTTATCACAGCCAC -3'
(R):5'- ATATGGGCGTTCCCTCAT -3'
Posted On2016-10-05