Incidental Mutation 'R5489:5730455P16Rik'
List |< first << previous [record 28 of 1308] next >> last >|
ID431998
Institutional Source Beutler Lab
Gene Symbol 5730455P16Rik
Ensembl Gene ENSMUSG00000057181
Gene NameRIKEN cDNA 5730455P16 gene
Synonyms
MMRRC Submission 043050-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.654) question?
Stock #R5489 (G1)
Quality Score223
Status Validated
Chromosome11
Chromosomal Location80360492-80378034 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 80377952 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000120606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103225] [ENSMUST00000134274] [ENSMUST00000179332]
Predicted Effect probably damaging
Transcript: ENSMUST00000103225
AA Change: D10E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099515
Gene: ENSMUSG00000057181
AA Change: D10E

DomainStartEndE-ValueType
low complexity region 7 31 N/A INTRINSIC
Pfam:Njmu-R1 38 390 1.5e-204 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000134274
AA Change: M1K
SMART Domains Protein: ENSMUSP00000120606
Gene: ENSMUSG00000057181
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 26 58 N/A INTRINSIC
Pfam:Njmu-R1 62 214 1.6e-84 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179332
AA Change: D10E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135972
Gene: ENSMUSG00000057181
AA Change: D10E

DomainStartEndE-ValueType
low complexity region 7 31 N/A INTRINSIC
Pfam:Njmu-R1 38 391 5.9e-231 PFAM
Meta Mutation Damage Score 0.6196 question?
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.6%
Validation Efficiency 95% (57/60)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 120,252,250 V817D probably damaging Het
Aqr T C 2: 114,133,073 N632S probably damaging Het
Bms1 T C 6: 118,413,745 T208A possibly damaging Het
Brd8 A T 18: 34,608,645 probably null Het
Caln1 G T 5: 130,414,832 R2L possibly damaging Het
Cdk17 A G 10: 93,232,412 T344A probably damaging Het
Chd8 A T 14: 52,213,048 probably benign Het
Clec14a A G 12: 58,268,249 F196L probably damaging Het
Clec2f T C 6: 129,020,486 noncoding transcript Het
Col4a1 A T 8: 11,312,550 probably benign Het
Col9a3 G A 2: 180,616,525 R579H probably damaging Het
Cyb561 A G 11: 105,935,523 V202A probably benign Het
Cyp2c69 T G 19: 39,851,159 Q340P probably null Het
D630003M21Rik T A 2: 158,217,021 T320S probably benign Het
D630045J12Rik A T 6: 38,196,847 S129T possibly damaging Het
Ddx54 A G 5: 120,624,721 T636A probably benign Het
Dnah8 T G 17: 30,790,956 F3774V probably damaging Het
Ern1 A G 11: 106,407,529 S674P probably damaging Het
Fam13a A T 6: 59,024,318 L8Q probably null Het
Fam83b T C 9: 76,545,599 N62S probably benign Het
Foxred1 A T 9: 35,209,970 V94E probably damaging Het
Frmd8 T A 19: 5,852,652 Q457L probably damaging Het
Gm1966 T A 7: 106,601,590 noncoding transcript Het
Heatr6 A G 11: 83,774,432 E741G probably damaging Het
Hnrnpab A G 11: 51,604,813 L133S probably damaging Het
Itga2 A T 13: 114,843,435 W1077R probably damaging Het
Kat6b A G 14: 21,669,264 D1228G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kmt2a A T 9: 44,841,038 probably benign Het
Leap2 T G 11: 53,422,413 *77C probably null Het
Mmp20 A G 9: 7,643,957 probably null Het
Mrps9 T G 1: 42,898,433 probably benign Het
Muc2 T C 7: 141,751,432 S158P probably benign Het
Mus81 T C 19: 5,487,889 probably benign Het
Nrip3 T C 7: 109,761,838 T210A probably damaging Het
Olfr591 T C 7: 103,173,451 Y62C probably damaging Het
Padi2 T C 4: 140,944,488 F509S probably damaging Het
Pcdha12 A G 18: 37,022,207 T660A probably benign Het
Pdzd2 G A 15: 12,382,676 P1197L probably benign Het
Rec8 A T 14: 55,622,826 Q291L probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sart3 A G 5: 113,771,380 W86R probably damaging Het
Slc17a4 A G 13: 23,898,842 probably null Het
Tdpoz1 T A 3: 93,670,667 Y270F possibly damaging Het
Thap3 T A 4: 151,985,652 probably benign Het
Tmem45a T A 16: 56,825,711 probably null Het
Trim43a A T 9: 88,582,176 I47F probably damaging Het
Vps13b A T 15: 35,770,542 I2044L probably benign Het
Zfp735 G A 11: 73,710,593 W121* probably null Het
Zmym2 A G 14: 56,956,255 K1176E possibly damaging Het
Other mutations in 5730455P16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:5730455P16Rik APN 11 80376812 missense possibly damaging 0.90
IGL03096:5730455P16Rik APN 11 80374179 missense probably damaging 1.00
R0383:5730455P16Rik UTSW 11 80363941 nonsense probably null
R0635:5730455P16Rik UTSW 11 80374065 splice site probably benign
R1376:5730455P16Rik UTSW 11 80363909 missense possibly damaging 0.90
R1376:5730455P16Rik UTSW 11 80363909 missense possibly damaging 0.90
R1598:5730455P16Rik UTSW 11 80364012 nonsense probably null
R1953:5730455P16Rik UTSW 11 80377946 missense probably damaging 1.00
R3236:5730455P16Rik UTSW 11 80368170 missense probably damaging 1.00
R4056:5730455P16Rik UTSW 11 80375503 splice site probably benign
R4612:5730455P16Rik UTSW 11 80377980 start codon destroyed probably null 0.90
R4777:5730455P16Rik UTSW 11 80374215 missense probably damaging 1.00
R4820:5730455P16Rik UTSW 11 80375520 missense possibly damaging 0.63
R4847:5730455P16Rik UTSW 11 80374114 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAGAGGACAGTGGCTTG -3'
(R):5'- GTTTCCAAGTCCAGGATTCGGG -3'

Sequencing Primer
(F):5'- ATCGGGCCAGAGACCTTG -3'
(R):5'- TCCAGGATTCGGGAGGCG -3'
Posted On2016-10-05