Incidental Mutation 'R0478:4930432E11Rik'
ID43200
Institutional Source Beutler Lab
Gene Symbol 4930432E11Rik
Ensembl Gene ENSMUSG00000046958
Gene NameRIKEN cDNA 4930432E11 gene
Synonyms
MMRRC Submission 038678-MU
Accession Numbers

NCBI RefSeq: none; Ensembl: ENSMUST00000053635; MGI:3045259

Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R0478 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29558579-29582169 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to T at 29562589 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000053635
SMART Domains Protein: ENSMUSP00000049518
Gene: ENSMUSG00000046958

DomainStartEndE-ValueType
Blast:WD40 43 79 3e-11 BLAST
WD40 131 172 1.97e2 SMART
WD40 175 214 2.24e-2 SMART
Blast:WD40 257 296 4e-15 BLAST
WD40 393 437 1.32e2 SMART
WD40 494 533 2.15e-4 SMART
low complexity region 598 617 N/A INTRINSIC
low complexity region 1082 1094 N/A INTRINSIC
low complexity region 1107 1148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000063585
SMART Domains Protein: ENSMUSP00000063695
Gene: ENSMUSG00000051976

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
internal_repeat_1 35 67 3.29e-5 PROSPERO
internal_repeat_1 73 102 3.29e-5 PROSPERO
low complexity region 122 135 N/A INTRINSIC
coiled coil region 161 182 N/A INTRINSIC
low complexity region 216 233 N/A INTRINSIC
low complexity region 239 249 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185541
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik T G 11: 3,976,259 probably benign Het
Acnat1 T G 4: 49,450,901 D70A probably damaging Het
Adnp2 A G 18: 80,129,334 V620A probably benign Het
Aldoart1 T A 4: 72,852,343 H21L probably benign Het
Birc3 A G 9: 7,860,347 V290A probably damaging Het
Bpifb3 C T 2: 153,931,480 probably benign Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Clmn A G 12: 104,785,491 M235T probably damaging Het
Dmbt1 A G 7: 131,041,187 E245G possibly damaging Het
Epgn G T 5: 91,031,128 V36L probably benign Het
Ets2 C A 16: 95,716,262 P346Q probably damaging Het
Fam222b T C 11: 78,153,856 L81P probably damaging Het
Fancf A C 7: 51,861,692 L188R probably damaging Het
Fibin T C 2: 110,362,734 D21G possibly damaging Het
Fzd6 A G 15: 39,034,034 probably null Het
Gbp4 T A 5: 105,119,433 Q540L probably benign Het
Greb1l T A 18: 10,509,281 L531Q probably damaging Het
Il5ra A G 6: 106,738,462 V137A probably benign Het
Kif26a G A 12: 112,175,789 A826T probably damaging Het
Kiz T C 2: 146,942,158 V537A possibly damaging Het
Klhl32 C T 4: 24,792,777 G15D probably damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lbp T C 2: 158,317,528 probably benign Het
Mmp25 T C 17: 23,632,782 T318A probably benign Het
Mrpl50 A G 4: 49,514,513 C53R probably damaging Het
Msl3l2 G C 10: 56,115,315 E45D probably damaging Het
Nfxl1 A G 5: 72,524,645 probably null Het
Noc3l A G 19: 38,810,006 probably null Het
Olfr1126 T A 2: 87,458,026 V287E probably damaging Het
Olfr1375 T C 11: 51,048,712 S202P probably benign Het
Pgm5 A T 19: 24,834,869 S100T possibly damaging Het
Pi4ka C T 16: 17,309,311 G1093S possibly damaging Het
Pitrm1 T A 13: 6,559,395 S350T probably damaging Het
Ptk2b G T 14: 66,213,372 N48K probably damaging Het
Sept3 T C 15: 82,290,806 L172P probably damaging Het
Sirt3 A T 7: 140,878,114 C41S probably benign Het
Sphkap C T 1: 83,278,711 R152H probably damaging Het
St3gal1 T C 15: 67,113,730 Y25C probably damaging Het
Tbc1d31 T C 15: 57,932,536 F175S probably damaging Het
Tfdp2 T A 9: 96,290,583 D43E probably benign Het
Tgm1 G A 14: 55,700,334 Q773* probably null Het
Tmc3 A T 7: 83,622,152 R837S possibly damaging Het
Unc13a A G 8: 71,651,148 V880A possibly damaging Het
Vmn1r237 T A 17: 21,314,819 V268E probably damaging Het
Zan C T 5: 137,400,526 probably benign Het
Zfp760 G T 17: 21,722,014 E57* probably null Het
Other mutations in 4930432E11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01121:4930432E11Rik APN 7 29574001 unclassified noncoding transcript
IGL01955:4930432E11Rik APN 7 29573995 unclassified noncoding transcript
IGL01971:4930432E11Rik APN 7 29574562 unclassified noncoding transcript
IGL02132:4930432E11Rik APN 7 29563279 unclassified noncoding transcript
IGL02484:4930432E11Rik APN 7 29563352 unclassified noncoding transcript
P0016:4930432E11Rik UTSW 7 29563112 unclassified noncoding transcript
R0051:4930432E11Rik UTSW 7 29579101 exon noncoding transcript
R0060:4930432E11Rik UTSW 7 29574170 unclassified noncoding transcript
R0094:4930432E11Rik UTSW 7 29560811 exon noncoding transcript
R0268:4930432E11Rik UTSW 7 29574602 unclassified noncoding transcript
R0423:4930432E11Rik UTSW 7 29562400 exon noncoding transcript
R0646:4930432E11Rik UTSW 7 29561285 exon noncoding transcript
R1208:4930432E11Rik UTSW 7 29561283 exon noncoding transcript
R1778:4930432E11Rik UTSW 7 29560706 exon noncoding transcript
R1779:4930432E11Rik UTSW 7 29579166 exon noncoding transcript
R1918:4930432E11Rik UTSW 7 29574089 unclassified noncoding transcript
R2360:4930432E11Rik UTSW 7 29574789 unclassified noncoding transcript
R3736:4930432E11Rik UTSW 7 29574571 unclassified noncoding transcript
R3780:4930432E11Rik UTSW 7 29560838 exon noncoding transcript
R4427:4930432E11Rik UTSW 7 29579253 exon noncoding transcript
R4835:4930432E11Rik UTSW 7 29574901 unclassified noncoding transcript
R4929:4930432E11Rik UTSW 7 29574042 unclassified noncoding transcript
R5042:4930432E11Rik UTSW 7 29574502 unclassified noncoding transcript
R5129:4930432E11Rik UTSW 7 29561361 exon noncoding transcript
R5371:4930432E11Rik UTSW 7 29562493 exon noncoding transcript
R5381:4930432E11Rik UTSW 7 29562968 unclassified noncoding transcript
R5586:4930432E11Rik UTSW 7 29577728 unclassified noncoding transcript
R5874:4930432E11Rik UTSW 7 29581185 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- CATAGTGTCCTGCCTAAACCTGCTC -3'
(R):5'- CAATGGTTCAGGAACCTCCTCAGC -3'

Sequencing Primer
(F):5'- GATAAACCTAAACACTTTGACCTTCG -3'
(R):5'- TCAGCCATCTCTTCATAGGATAAAC -3'
Posted On2013-05-23