Incidental Mutation 'R5491:1810041L15Rik'
List |< first << previous [record 55 of 18487] next >> last >|
ID432096
Institutional Source Beutler Lab
Gene Symbol 1810041L15Rik
Ensembl Gene ENSMUSG00000062760
Gene NameRIKEN cDNA 1810041L15 gene
Synonyms
MMRRC Submission 043052-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5491 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location84379203-84447097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 84406510 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 199 (V199L)
Ref Sequence ENSEMBL: ENSMUSP00000141117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080751] [ENSMUST00000189248] [ENSMUST00000189994]
Predicted Effect probably benign
Transcript: ENSMUST00000080751
AA Change: V179L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079575
Gene: ENSMUSG00000062760
AA Change: V179L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189248
AA Change: V199L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141117
Gene: ENSMUSG00000062760
AA Change: V199L

DomainStartEndE-ValueType
transmembrane domain 31 50 N/A INTRINSIC
transmembrane domain 119 141 N/A INTRINSIC
low complexity region 172 198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189994
SMART Domains Protein: ENSMUSP00000140712
Gene: ENSMUSG00000062760

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.0%
  • 20x: 89.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf G T 19: 31,918,062 A182S possibly damaging Het
Aldh1l2 A T 10: 83,522,785 D2E probably benign Het
Bach2 G T 4: 32,562,681 D383Y probably damaging Het
Cd248 T C 19: 5,070,209 L695P probably damaging Het
Cela1 T A 15: 100,682,980 N132Y probably damaging Het
Cisd2 A T 3: 135,408,840 D123E probably damaging Het
Col6a6 T A 9: 105,738,236 D1571V probably damaging Het
Fam71e2 T C 7: 4,757,926 I596V probably benign Het
Fbxo48 C T 11: 16,954,280 T144M probably damaging Het
Fbxo7 C A 10: 86,048,026 P497Q probably damaging Het
Gm12695 T A 4: 96,769,668 H88L possibly damaging Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gpat4 A G 8: 23,180,664 I133T probably benign Het
Hmcn1 C T 1: 150,609,825 probably null Het
Ncaph T C 2: 127,123,675 T252A probably benign Het
Nebl G T 2: 17,434,972 Y163* probably null Het
Neurod4 C T 10: 130,271,067 V113I possibly damaging Het
Olfr1305 T A 2: 111,873,562 I98F probably benign Het
Olfr411 A T 11: 74,346,914 H103Q probably benign Het
Olfr71 A G 4: 43,705,990 S193P probably damaging Het
Pbxip1 T A 3: 89,443,159 M37K probably benign Het
Phactr2 T C 10: 13,261,846 N184S possibly damaging Het
Phf20l1 C T 15: 66,615,785 P480L possibly damaging Het
Psme4 T C 11: 30,815,246 S538P possibly damaging Het
Rassf1 T A 9: 107,561,415 M228K possibly damaging Het
Rpn2 A G 2: 157,297,383 D231G probably damaging Het
She A T 3: 89,831,790 D96V probably damaging Het
Tmem260 T A 14: 48,512,170 probably null Het
Ttn T A 2: 76,732,358 I28751F probably damaging Het
Zfp60 T G 7: 27,748,515 probably null Het
Other mutations in 1810041L15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01887:1810041L15Rik APN 15 84406650 missense probably damaging 1.00
IGL02381:1810041L15Rik APN 15 84406453 missense probably damaging 1.00
IGL02826:1810041L15Rik APN 15 84420129 splice site probably benign
R1604:1810041L15Rik UTSW 15 84406471 missense probably benign 0.01
R1823:1810041L15Rik UTSW 15 84406468 missense probably benign 0.00
R2246:1810041L15Rik UTSW 15 84417199 missense probably damaging 1.00
R3771:1810041L15Rik UTSW 15 84406685 nonsense probably null
R3772:1810041L15Rik UTSW 15 84406685 nonsense probably null
R3773:1810041L15Rik UTSW 15 84406685 nonsense probably null
R4805:1810041L15Rik UTSW 15 84417196 missense probably damaging 1.00
R5070:1810041L15Rik UTSW 15 84420163 missense possibly damaging 0.56
R5114:1810041L15Rik UTSW 15 84417226 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAGTCCTCCTTGGCGAAC -3'
(R):5'- GATTTACGGCTTCTTCGTGC -3'

Sequencing Primer
(F):5'- TCCTCCTTGGCGAACAGGAAG -3'
(R):5'- CTATTATTCCGCCATGAACTACG -3'
Posted On2016-10-05