Incidental Mutation 'R5491:Cela1'
ID432097
Institutional Source Beutler Lab
Gene Symbol Cela1
Ensembl Gene ENSMUSG00000023031
Gene Namechymotrypsin-like elastase family, member 1
Synonyms1810062B19Rik, Ela1, Ela-1, 1810009A17Rik, PC-TsF
MMRRC Submission 043052-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R5491 (G1)
Quality Score98
Status Not validated
Chromosome15
Chromosomal Location100674421-100687921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100682980 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 132 (N132Y)
Ref Sequence ENSEMBL: ENSMUSP00000023775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023775] [ENSMUST00000229869] [ENSMUST00000230572] [ENSMUST00000230740] [ENSMUST00000230744]
Predicted Effect probably damaging
Transcript: ENSMUST00000023775
AA Change: N132Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023775
Gene: ENSMUSG00000023031
AA Change: N132Y

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Tryp_SPc 26 259 1.24e-88 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229235
Predicted Effect probably benign
Transcript: ENSMUST00000229869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229888
Predicted Effect unknown
Transcript: ENSMUST00000230312
AA Change: N69Y
Predicted Effect probably benign
Transcript: ENSMUST00000230572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230642
Predicted Effect probably benign
Transcript: ENSMUST00000230740
Predicted Effect probably benign
Transcript: ENSMUST00000230744
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.0%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. Humans have six elastase genes which encode the structurally similar proteins elastase 1, 2, 2A, 2B, 3A, and 3B. Unlike other elastases, pancreatic elastase 1 is not expressed in the pancreas. To date, elastase 1 expression has only been detected in skin keratinocytes. Clinical literature that describes human elastase 1 activity in the pancreas or fecal material is actually referring to chymotrypsin-like elastase family, member 3B. [provided by RefSeq, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik C A 15: 84,406,510 V199L probably benign Het
A1cf G T 19: 31,918,062 A182S possibly damaging Het
Aldh1l2 A T 10: 83,522,785 D2E probably benign Het
Bach2 G T 4: 32,562,681 D383Y probably damaging Het
Cd248 T C 19: 5,070,209 L695P probably damaging Het
Cisd2 A T 3: 135,408,840 D123E probably damaging Het
Col6a6 T A 9: 105,738,236 D1571V probably damaging Het
Fam71e2 T C 7: 4,757,926 I596V probably benign Het
Fbxo48 C T 11: 16,954,280 T144M probably damaging Het
Fbxo7 C A 10: 86,048,026 P497Q probably damaging Het
Gm12695 T A 4: 96,769,668 H88L possibly damaging Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gpat4 A G 8: 23,180,664 I133T probably benign Het
Hmcn1 C T 1: 150,609,825 probably null Het
Ncaph T C 2: 127,123,675 T252A probably benign Het
Nebl G T 2: 17,434,972 Y163* probably null Het
Neurod4 C T 10: 130,271,067 V113I possibly damaging Het
Olfr1305 T A 2: 111,873,562 I98F probably benign Het
Olfr411 A T 11: 74,346,914 H103Q probably benign Het
Olfr71 A G 4: 43,705,990 S193P probably damaging Het
Pbxip1 T A 3: 89,443,159 M37K probably benign Het
Phactr2 T C 10: 13,261,846 N184S possibly damaging Het
Phf20l1 C T 15: 66,615,785 P480L possibly damaging Het
Psme4 T C 11: 30,815,246 S538P possibly damaging Het
Rassf1 T A 9: 107,561,415 M228K possibly damaging Het
Rpn2 A G 2: 157,297,383 D231G probably damaging Het
She A T 3: 89,831,790 D96V probably damaging Het
Tmem260 T A 14: 48,512,170 probably null Het
Ttn T A 2: 76,732,358 I28751F probably damaging Het
Zfp60 T G 7: 27,748,515 probably null Het
Other mutations in Cela1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1845:Cela1 UTSW 15 100685167 missense probably benign 0.43
R2060:Cela1 UTSW 15 100675322 critical splice donor site probably null
R2358:Cela1 UTSW 15 100681228 missense probably benign
R3968:Cela1 UTSW 15 100684653 missense probably damaging 1.00
R4236:Cela1 UTSW 15 100682913 missense probably damaging 1.00
R6140:Cela1 UTSW 15 100681156 missense probably benign 0.01
R6378:Cela1 UTSW 15 100687190 missense probably benign 0.00
R7057:Cela1 UTSW 15 100682893 missense possibly damaging 0.90
R7536:Cela1 UTSW 15 100675364 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGCCCTAGACACCTAGC -3'
(R):5'- CACATCTAATGTCCAGCAGCTC -3'

Sequencing Primer
(F):5'- TAGCCATTTCACCAAACTTCAGTGG -3'
(R):5'- AGCTCAACTGCTTCCACG -3'
Posted On2016-10-05